Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.

The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC

What you'll see is this:

As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:

For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).

Using STADEN for Sequence Assembly by RuneStensvold

When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

This Month In Blastocystis Research (MAR 2014)

If there's one paper that really made my eye balls pop over the past 30 days, it's the paper appearing a couple of days ago in BMC Infectious Diseases by Safadi et al. on Blastocystis in a cohort of Senegalese children. The paper is open access and can be downloaded here. But I'll be jumping right at it:

A 100% prevalence of Blastocystis in a cohort of 93 Senegalese children! 

The children represented a mixed group of children with and without symptoms. And yes, they were all colonised!

Are Senegalese children obligate carriers of Blastocystis? Image courtesy of whl.travel.

I will not at all try and discuss the potential clinical implications of this. I don't think we currently have the appropriate tools to ascertain to which extent a 100% Blastocystis prevalence is a public health problem. 

However, technically and scientifically, I'm extremely pleased to see a study like this one. My group and some of my colleagues have somewhat similar data in the pipeline, and it's great to see this next generation of survey data emerging from different regions of the world, based on the use of highly sensitive molecular tools to screen for Blastocystis. I cannot emphasise the importance of this too much.

The authors hoovered faecal samples from the children for Blastocystis-specific DNA using both PCR + sequencing (barcode region) and real-time PCR. Importantly, quite a few samples negative by barcoding were positive by real-time PCR, and so if the authors had included only PCR + sequencing, the prevalence would have been only 75% or so. It may be not very surprising that barcoding PCR did not pick up all cases of Blastocystis, but then again, it has always been known that the barcoding PCR is not diagnostic - one of the primers, RD5, is a general eukaryotic primer, while the other one, BhRDr is Blastocystis-specific. Also, the PCR product is about 600 bp; diagnostic PCRs should preferably be designed to produced much smaller amplicons (100 bp or so) for a variety of reasons.

The research team subtyped all samples, and found ST3 to be the most prevalent subtype - colonising about 50% of the children. ST1 and ST2 were also common, while ST4 was found in only 2 children and only in mixed infections. Mixed subtype infections was seen in 8 cases. Note the small fraction of ST4. This subtype is very common in Europe but seems to be rare in most other regions.

There is no doubt that we with molecular tools are now starting to obtain data that represent a more precise snapshot of reality than before when tools of low sensitivity and unable to give strain information were used. And while qPCR can take us a long way in terms of precisely distinguishing positive from negative samples, we still have an amplification step that may interfere with the DNA information that we obtain. The French group involved in this study has over multiple studies done  an admirable job in terms of pursuing the extent of mixed subtype infections. Whether the data are based on sequencing of PCR products amplified by genus-specific primers, or whether real-time PCR  using genus-specific primers is used, it can still be argued that these methods have limitations due to application of genus-specific primers in both cases. It is going to be interesting to compare the evidence that we have collected from subtyping over the past few years with analysis of metagenomics data, which are independent of PCR amplification, and thus not subject to potential bias. 

A 100% prevalence means that transmission pressure is massive. Three subtypes are common. Still, mixed infections are present in less than 10%. If this is indeed a realistic picture, this may imply that once established, a Blastocystis strain is capable of keeping other strains at bay? In keeping with waht I said above, it is also possible that the extent of mixed infections is higher, and that the PCR methods only detect the more predominant strain, making the prevalence of mixed ST infection seem low.

It's tempting to believe that such a high prevalence of Blastocystis compared to Europe is due to exposure to contaminated water, but how does this explain a whopping 30% Blastocystis prevalence in the background population in Denmark, a country characterised by supreme hygienic standards and 'perfect plumbing' with all potable water being pumped up from the ground (ie. hardly no surface water)? Have all individuals positive for Blastocystis in Denmark been out traveling to more exotic countries with less well controlled water infrastructures? Or is Blastocystis just highly transmissible through e.g. direct contact? And will all who are exposed develop colonisation? What are the determinants? It's probably not fair to dismiss the idea of Blastocystis being waterborne (as one of the modes of transmission) due to the fact that Blastocystis has not been cause of waterborne outbreaks. If Blastocystis is non-pathogenic, it can easily be transmitted by water. In fact, if Blastocystis is waterborne and never gives rise to outbreaks, what does this tell us about it's pathogenic potential? Well, acute disease such as that seen for some bacteria, viruses, and Cryptosporidium, Giardia and microsporidia is probably not something that is associated with the organism.

I could have wished for allele analysis of the subtypes detected. It should be possible in all cases where barcode sequences were available, - simply and easy using this online tool. But the data is available in GenBank so everyone interested can have a look. 

There is plenty of interesting things to address, but for now I'll leave it here, and on behalf of all of us interested in Blastocystis research just thank the people behind the paper for publishing this important study!

And nope, this is no April Fool!

Literature:

El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, & Viscogliosi E (2014). Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infectious Diseases, 14 (1) PMID: 24666632

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438

Blastocystis Parasite Blog - 2 Years Anniversary!

Today marks the 2 Years Anniversary of the Blastocytis Parasite Blog! And tomorrow my daughter will be turning three, so there is plenty of reason to celebrate!

My 'Birthday Special' is a collection of links to blog posts that are among the most popular or most unusual ones; a couple of them have been slightly edited (typos and updates).

But before that just a couple of announcements:
A colleague of mine will be at the Digestive Diasese Week in Chicago from 3-6 May 2014 presenting an abstract with the title: 'Dientamoeba fragilis and Blastocytis - two parasites associated with gastrointestinal health'. The title may have a harsh connotation to some, but soon I will be posting the abstract here on the blog, and you will understand why we chose this title.

Next, I'd like to encourage colleagues to come up with suggestions for topics and guest bloggers.

Soon, I'll be doing a separate post on tools available for students/researchers to detect and characterise Blastocystis in samples from humans and animals.

That's it for now; here are the links!

1. The Circular Problem of Blastocystis
2. Amelioration of Colitis by Parasites - or "An Elliot & Weinstock Special"
3. Do IBS Patients Lack Blastocystis and Dientamoeba??
4. Micro-Eukaryotic Diversity in The Human Instestine
5. Blastocystis aux Enfers

What's In A Name?

When people have had their stools examined and are told that they have Blastocystis, most of them will not have a clue about what that is. And eventually they'll be told that it's a parasite. A parasite? As in tapeworm? Ok it's not. But then what? As in malaria? Oh... ok, I see... So it's....? Huh? As in ... what???

Now, which are those parasites in and on your body, and what in fact makes a parasite? Depends on who you ask. For parasitologists and public health/clinical microbiologists, a parasite means something along the lines of a eukaryotic organism (i.e. not a bacterium and not a virus) that is not a fungus and that is capable of living and maybe even multiplying on or inside another organism. Some organisms are considered somewhere in between parasites and fungi, such as microsporidia and Pneumocystis. But whether an organism is a fungus or a parasite is not important in most cases. You will also sometimes see that 'parasite' is used as a term meant to cover living organisms causing disease, and in this sense the term may include for instance bacteria and viruses; for instance. A lot of research deals with 'host-parasite' relationships, evolution of virulence and tolerance in parasites and hosts, respectively; also here, bacteria may be referred to as parasites.

 Mosquitos are practically parasites that may transmit other parasites. Source (eyeweed on Flickr).

The word 'parasite' stems from Greek, and means something like 'eating beside' or 'eating at someone else's table'. Parasitism is a non-mutual symbiotic relationship where one organism (the parasite) benefits at the expense of another (the host).

People like me usually divide parasites (sensu stricto) into protozoa (single-celled) and helminths (multi-cellular; worms). Effectively, this should be protists and helminths, since not all single-celled parasitic eukaryotes are protozoa. Please note that most protists and helminths (the nematode fraction) are free-living, - but some have adapted a parasitic life style and very effectively so.

So, when we're told by doctors that we are in fact hosting parasites, - how do we react? I guess  some of us will be quite alarmed: Creatures eating defenseless hosts from within, castrating them and turning them into zombies come to our minds, for instance Sacculina, Dicrocoelium, and Leucochloridium, just to mention a few ones (if you're not familiar with these ones, I suggest you look them up - you will hardly believe what they are capable of doing, and despite the horrifying subtlety and cold-bloodedness with which these creatures operate, one can hardly help marveling on how cunningly evolution makes way for some organisms' ability to exploit others). Other parasites are known to cause less spectacular phenotypic changes while having huge consequences for human health and disease: Malaria continues to be a significant cause of morbidity and mortality in many larger regions, and recently, diarrhoea caused by species of Cryptospordium was recognised as one of the most significant health issues in infants and toddlers in select sentinel areas sub-Saharan Africa and South Asia.

Some parasites, however, are commensals (ie. they just sit there with a more or less neutral outcome) or even beneficial to the host; for instance, there's evidence of ciliates assisting herbivores in metabolising cellulose. So while, these organisms from one point of view are parasites, the hole symbiotic relationship between these protozoa and herbivores may be seen as mutualistic. Maybe this particular relationship started out as 'parasitsm' but developed into 'mutualism'? There may be a lot more examples of this. Animals usually host various types of parasites, and humans probably used to host a much larger zoo of parasites than many of us do today; what is the public health significance of the recent and rapid 'defaunation' of humans in certain parts of the world?

At least technically, Blastocystis is also a parasite: Sitting in the colon, it lives on food delivered by its host, and thereby it certainly eats at someone else's table. Moreover, the parasite is probably not capable of completing its life cycle without a host. But what does it do apart from eating? Does it do us any good just like the ciliates in the herbivores? Blastocystis has co-evolved with humans (and other host species) and maybe humans have learned to exploit Blastocystis so that it's not only Blastocystis exploiting us? Does Blastocystis compete with other organisms in the gut? Does it secrete substances that impact other organisms including the host, and if so, in what way? What's its impact on the immune system? Etc.

I guess the take-home message here is that 'parasite' is just a word, - a name for something, and there are examples of parasitism turning into mutualism. Not all parasites induce disease, and parasites are not always organisms that should be sought eradicated.

Literature:

Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow SO, Sur D, Breiman RF, Faruque AS, Zaidi AK, Saha D, Alonso PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T, Kanungo S, Ochieng JB, Omore R, Oundo JO, Hossain A, Das SK, Ahmed S, Qureshi S, Quadri F, Adegbola RA, Antonio M, Hossain MJ, Akinsola A, Mandomando I, Nhampossa T, Acácio S, Biswas K, O'Reilly CE, Mintz ED, Berkeley LY, Muhsen K, Sommerfelt H, Robins-Browne RM, & Levine MM (2013). Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet, 382 (9888), 209-22 PMID: 23680352

Veira DM (1986). The role of ciliate protozoa in nutrition of the ruminant. Journal of Animal Science, 63 (5), 1547-60 PMID: 3098727

This Month In Blastocystis Research (FEB 2014) - The Protease Edition

A few interesting papers on Blastocystis appeared this month on PubMed. I would like to give a great salute to Ron Fayer's group in Maryland who took to investigating faecal samples and tissue sections from naturally infected pigs. Due to the protease theme of this blog post, I won't go into detail with this paper, but only highlight a few points. The researchers found Blastocystis ST5 in faecal samples from all 11 pigs investigated. By examination of tissue sections they found that Blastocystis existed in the lumen of the jejunum, caecum, proximal and distal colon, but not in the duodenum and ileum. Moreover:

"In tissue sections, Blastocystis was found primarily in the lumen usually associated with digested food debris, sometimes in close proximity or appearing to adhere to the epithelium, but no stages were found to penetrate the epithelium or the lamina propria."

So, the authors did a great job to describe Blastocystis tropism in the pig intestine. It is new to me that the parasite can be found in the jejunum; if anything, I would have thought that the ileum might be 'affected', and certainly the caecum and possibly the remainder of the colon. It is also important to note that in these naturally infected pigs (ST5 is probably the most common subtype in pigs), no signs of invasiveness was detected.

Now, moving on to the proteases, there is a paper out by Arutchelvan Rajamanikam and Suresh K Govind called 'Amoebic forms of Blastocystis spp. - evidence for a pathogenic role'. The study links protease activity to amoebic forms of Blastocystis, which the authors found in symptomatic carriers but not in asymptomatic carriers. Amoeboid forms of Blastocystis being associated with symptomatic infections were described already in 2006 by T C Tan and K G Suresh (whom I believe is identical to S K Govind). While the study is small, investigation of Blastocystis proteases has been going on for a while, and I thought it would be useful to go over some of the literature.

Proteases (or proteinases or peptidases) are enzymes that degrade proteins and therefore useful for instance for the mobilisation and storage of proteins (i.e. 'food'), and the general development and differentiation of cells and tissues, but these enzymes may also be vital for for instance pathogen survival and virulence in the human body (i.e. 'defence' and 'invasion'). Proteases exist in all organisms, i.e. in pro- and eukaryotes + viruses. Proteases are classified on the basis of catalytic mechanism, and five known distinct classes are described: metallo, aspartic, cysteine, serine, and threonine. Being enzymes, proteases digest substrates, can be inhibited, and their functions are dependent on pH and temperature. Hence, proteases can be identified by substrate digestion and by intended inhibition by selective inhibitors (for cystein protease such inhibitors include N-ethylmaleimide, iodoacetamide, and para-hydroxymercuribenzoate for instance).

Turning to the intestinal protozoon Entamoeba for a short while, cysteine proteases have been studied in detail and are among the most likely candidates responsible for the differential pathogenocitiy (virulence factors) of morphologically similar species of Entamoeba: Entamoeba histolytica expresses at least 5 types of cysteine proteases (ACP1, ACP2, ACP3, EhCP5, and EhCP112) and can invade host tissue (leading to amoebiasis), while Entamoeba dispar expresses at least three types of cysteine proteases (EdCP1, EdCP2, and EdCP3) without the ability to invade host tissue. Clinical isolates of E. histolytica release 10- to 1,000-fold more cysteine proteinase activity into the supernatant than E. dispar isolates, although  significant day-to-day variability may be seen. Extracellular cysteine proteases cleave immune secretory IgA (facilitating adhesion of the organism (pathogen) to mucosal surfaces), degrade the extracellular matrix, activate complement, and degrade IgG to circumvent the host immune response. The first evidence of amoebic pathology is local depletion of intestinal mucus and disruption of the epithelial barrier as a result of degradation of the extracellular matrix, which occurs in part from the action of cysteine proteases. More than 80% of patients with amoebiasis develop antibodies against cysteine proteases. Please note that E. histolytica is not consistently invasive; only 10% of E. histolytica infections are believed to be invasive.

Importantly, cysteine proteases are critical to host invasion in a number of parasites. Specific inhibitors block invasion in Trypanosoma cruzi, Plasmodium falciparum, Cryptosporidium parvum, and Toxoplasma gondii.

The main reservoir of Blastocystis ST7 appears to include birds.

Now what do we know about Blastocystis and cysteine proteases? In 2005, Manoj K Puthia from Dr Kevin S W Tan's group in Singapore identified mainly cysteine protease activity in the 'B. hominis B' strain (which is the ST7 strain used in the genome sequencing and annotation study by Denoeud et al. (2011)) and aspartic protease activity in 'B. ratti WR1 strain' (which is a ST4 strain). Lysates and conditioned medium (culture supernatant) from both axenic strain cultures were able to degrade human secretory IgA over 2 h at 37 C, suggesting that Blastocystis actively secrets proteases that - among other things - degrade IgA, thereby potentially evading host mucosal immunity, and enhancing survival opportunities. Along theses lines, in 2006 Sio and colleagues from Tan's group used enzyme digestion (azocasein spectrophotometric assay and gelatin SDS-PAGE analysis), and inhibition assays to characterise proteases from 'B. hominis B' strain. They showed the existence of cysteine proteases with highest activity at neutral pH (the pH of the colon is neutral if even slightly acidic).

Mirza and Tan confirmed that cysteine protease activity was higher in ST7 than in ST4, while inter- and intra-subtype variation in activity was seen over time. In a small study of ST3 positive individuals, Abdel-Hameed and Hassanin were able to detect protease activity in 17/18 symptomatic individuals but only in 2/8 asymptomatic individuals, suggesting intra-subtype differential protease activity. I don't think they tested for protease activity in the culture supernatant.

Cysteine proteases from Blastocystis were reported by Puthia et al. (2008) to enable activation of interleukin 8 (IL-8) gene expression in the human colonic epithelial T84 cell line. IL-8 is a cytokine that attracts PMN and activates monocytes (interestingly, recent results from Olivo-Diaz et al. (2012) suggest that some IL-8 and IL-10 SNPs could change individual susceptibility increasing the relative risk in the development of irritable bowel syndrome (IBS) in Blastocystis carriers).

Gastrointestinal disorders, such as bacterial enteritis, celiac disease, and inflammatory bowel disease, are reported to be associated with a breakdown of epithelial barrier function which is mainly regulated by 'tight junctions'. There is some experimental evidence that Blastocystis may be able to interfere with this regulation and that it may induce host cell apoptosis without attaching to the gut mucosa. Puthia et al. (2006) explain:

"Pathogen invasion and induction of apoptosis are discrete processes, and there are pathogens that can invade but do not induce apoptosis. It appears that induction of apoptosis of host intestinal cells would not be advantageous to a noninvasive parasite like Blastocystis, as it would result in the loss of colonization sites for the parasite. This unintended induction of host cell apoptosis might be a host response against some parasitic factors like proteases which are necessary for the parasite's own life cycle."

Back to the paper by Rajamanikam and Govind: I cannot remember ever seeing amoeboid stages in Blastocystis cultures myself. But then again, in cultures, Blastocystis can take so many forms (some actually resembling the outline of the head of, well, Mickey Mouse (!) and other cuddly creatures (looks like budding off of new cells), and I wouldn't be able to define strict criteria for stratification of organisms into groups. Since we use Jones' Medium also, I do not suspect that it's a 'medium thing'. What we usually see in well-maintained cultures are small, quite inconspicuous and completely spherical cells. Using the aforementioned digestion assays, Rajamanikam and Govind found elevated protease activity related to patient Blastocystis cultures that had a higher percentage of amoebic forms with intense bands representing higher molecular weight proteases (60-100 kDa); the proteases previously described have been of a size of maximum 75 kDa; however, no attempts were made to characterise the proteases in this study. The authors did not include analysis of conditioned medium, and so we do not know whether these proteases were actually secreted. The proteases identified here may be expressed by the amoebic forms only and so they may be responsible for this particular life cycle stage. Knowledge of substrate specificity might have been useful, and it is also possible to actually determine the protein's amino acid sequence and thereby predict it's structure and function using e.g. mass spectrometry (MS) or Edman degradation of peptides.

Just like Ivan Wawrzyniak and colleagues who recently used SDS-PAGE and MS to characterise proteases secreted by the Blastocystis ST7 (B strain). They were able to match two cysteine proteases identified in the culture supernatant to 2 of 22 proteases predicted by in silico analysis of their ST7 B strain genome data, namely Cathepsin B cysteine protease (CBCP) and a Legumain cysteine protease, which the authors speculated to be potentially involved in pathological processes such as mucin degradation. Incidentally, silencing of CBCP has recently been shown to reduce gut penetration in the helminth Faciola hepatica.

Back in 2007, Jésus Serrano-Luna and colleagues studied proteases from pathogenic Naegleria fowleri (causing primary amoebic meningoencephalitis) and non-pathogenic Naegleria gruberi. They observed cysteine proteases in both species, but more proteases in the N. gruberi than in N. fowleri. Protease activity appeared to depend on pH and temp, and moreover, protease patterns for crude extracts and conditioned medium differed

It's probably fair to assume that the expression of potential virulence genes such as genes encoding cysteine proteases may depend on a multiple factors, most of which are yet to be identified, or at least, confirmed. For now, the marked differences in cysteine protease production/expression between and within Blastocystis STs together with experimental evidence highlighting a variation in pathophysiological effects and immunological responses to Blastocystis subtypes isolated from symptomatic and asymptomatic carriers, could be seen as supporting the hypothesis that cysteine proteases may be essential virulence factors responsible for variation in disease symptoms observed across carriers. For more on this, why not look up this paper (free in PubMed Central). However, it is also tempting to think that differential protease expression is merely reflecting various stages in the parasite's life cycle. Things would have been so much easier if we had access to a strain in culture capable of invasion or isolated from an outbreak of Blastocystis infection. But, contrary to parasites of 'acknowledged clinical significance', we do not have such a strain, and neither invasion nor outbreaks of Blastocystis have been reported of, at least not convincingly, I think; please correct me, if I'm wrong. I think it's time for a coffee...

Literature:

Abdel-Hameed DM, & Hassanin OM (2011). Proteaese activity of Blastocystis hominis subtype 3 in symptomatic and asymptomatic patients. Parasitology Research, 109 (2), 321-7 PMID: 21279383

Denoeud F, Roussel M, Noel B, Wawrzyniak I, Da Silva C, Diogon M, Viscogliosi E, Brochier-Armanet C, Couloux A, Poulain J, Segurens B, Anthouard V, Texier C, Blot N, Poirier P, Ng GC, Tan KS, Artiguenave F, Jaillon O, Aury JM, Delbac F, Wincker P, Vivarès CP, & El Alaoui H (2011). Genome sequence of the stramenopile Blastocystis, a human anaerobic parasite. Genome Biology, 12 (3) PMID: 21439036 

Fayer R, Elsasser T, Gould R, Solano G, Urban J Jr, & Santin M (2014). Blastocystis tropism in the pig intestine. Parasitology Research PMID: 24535732

McGonigle L, Mousley A, Marks NJ, Brennan GP, Dalton JP, Spithill TW, Day TA, & Maule AG (2008). The silencing of cysteine proteases in Fasciola hepatica newly excysted juveniles using RNA interference reduces gut penetration. International Journal for Parasitology, 38 (2), 149-55 PMID: 18048044

Mirza H, & Tan KS (2009). Blastocystis exhibits inter- and intra-subtype variation in cysteine protease activity. Parasitology Research, 104 (2), 355-61 PMID: 18846388

Olivo-Diaz A, Romero-Valdovinos M, Gudiño-Ramirez A, Reyes-Gordillo J, Jimenez-Gonzalez DE, Ramirez-Miranda ME, Martinez-Flores WA, Martinez-Hernandez F, Flisser A, & Maravilla P (2012). Findings related to IL-8 and IL-10 gene polymorphisms in a Mexican patient population with irritable bowel syndrome infected with Blastocystis. Parasitology Research, 111 (1), 487-91 PMID: 22287022

Poirier P, Wawrzyniak I, Vivarès CP, Delbac F, & El Alaoui H (2012). New insights into Blastocystis spp.: a potential link with irritable bowel syndrome. PLoS Pathogens, 8 (3) PMID: 22438803

Puthia MK, Vaithilingam A, Lu J, & Tan KS (2005). Degradation of human secretory immunoglobulin A by Blastocystis. Parasitology Research, 97 (5), 386-9 PMID: 16151742

Puthia MK, Sio SW, Lu J, & Tan KS (2006). Blastocystis ratti induces contact-independent apoptosis, F-actin rearrangement, and barrier function disruption in IEC-6 cells. Infection and Immunity, 74 (7), 4114-23 PMID: 16790785

Que X, & Reed S L (2000). Cysteine Proteinases and the Pathogenesis of Amebiasis. Clinical Microbiology Reviews, 13 (2), 196-206 DOI: 10.1128/CMR.13.2.196-206.2000

Rajamanikam A, & Govind SK (2013). Amoebic forms of Blastocystis spp. - evidence for a pathogenic role. Parasites & Vectors, 6 (1) PMID: 24499467

Serrano-Luna J, Cervantes-Sandoval I, Tsutsumi V, & Shibayama M (2007). A biochemical comparison of proteases from pathogenic Naegleria fowleri and non-pathogenic Naegleria gruberi. The Journal of Eukaryotic Microbiology, 54 (5), 411-7 PMID: 17910685

Sio SW, Puthia MK, Lee AS, Lu J, & Tan KS (2006). Protease activity of Blastocystis hominis. Parasitology Research, 99 (2), 126-30 PMID: 16518611 

Wawrzyniak I, Texier C, Poirier P, Viscogliosi E, Tan KS, Delbac F, & El Alaoui H (2012). Characterization of two cysteine proteases secreted by Blastocystis ST7, a human intestinal parasite. Parasitology International, 61 (3), 437-42 PMID: 22402106 

'Save the Date's + Resources

Some 'Save the Date's:

1. ASM Meeting, Boston, MAY 2014:
Speaker: Christen Rune Stensvold 
Session Title: Passion for Parasites! Current Topics in Medical Parasitology 
Session Date/Time:  5/18/2014 8:00:00 AM 
Presentation Title: Blastocystis Clinical Relevance: More Common and Important than You Think


2. ICOPA, Mexico City, AUGUST 2014:

UNU-BIOLAC has accepted to fund the MOLECULAR PARASITOLOGY WORKSHOP-ICOPA 2014 to be held in Mexico city August 7-10! pic.twitter.com/YbTjUI0MFt
— Chr. Rune Stensvold (@Eukaryotes) February 22, 2014

 
3. 1st International Blastocystis Symposium, Ankara, 28-29 MAY 2015:

Please go here for more information.



Just found out that out of 1065 Blastocystis papers in PubMed, 269 are can be downloaded for free! If you enter 'Blastocystis' in the search box, you'll see the 1065 or so hits, but if you go to the right side bar, you have the option of having the Free Full Text (269) display.

I have disabled Google+ comments for now due to repetitive abuse. However, it is still possible to comment on blog posts, only now comments will be reviewed and potentially moderated by me prior to publishing.

In case there should be readers who think that I'm trying to propagate the view that Blastocystis is pathogenic, I hope that after going through my blog posts they will realise that I'm not; in fact, I'm much more trying to be the devil's advocate: Blastocystis is 'innocent' unless proven otherwise. In my opinion we have very little clinical evidence of pathogenicity. And at our lab, we generally do not recommend treating patients with Blastocystis. In fact, we really don't know HOW to treat Blastocystis, - and maybe that's one of the most fundamental issues in Blastocystis research. I know that many treatment regimens are currently in use for Blastocystis despite the absence of clinical guidelines, and some of them are used systematically at various clinics it seems, but off the top of my head I cannot think of one single randomised controlled treatment study that have explored the microbiological and clinical effect of treatment. Such studies are critical to our understanding of  the role of the parasite in health and disease, although even this type of studies have limitations such as non-specific drug actions that will blur our ability to point out Blastocystis as the culprit, and also some drugs may have adverse effects that mimic symptoms potentially caused by Blastocystis, including symptoms related to intestinal dysbiosis. I hope that those who have extensive experience with Blastocystis treatment will soon take to sharing their knowledge.

But I guess that what we are currently trying in various fields is to get a differentiated view of Blastocystis - for instance: can colonisation turn into infection, and is there any such thing as a Blastocystis infection at all? Can, and if so, when does Blastocystis carriage lead to pathology/disease? Which are the interactions between Blastocystis and the remaining microbiota? What host factors may be responsible for potential differences in Blastocystis-mediated disease susceptibility?

Don't miss the February issue of 'This Month In Blastocystis Research' which will be available in a week or so.