This Month in Blastocystis Research (FEB 2016) - Rash Edition

A couple of years ago, I contributed to writing up a Case Report on what appeared to be Blastocystis-associated urticaria (hives). Receiving various courses of ineffective antibiotic treatment with a view to eradicating Blastocystis, a woman continued to suffer from gastrointestinal symptoms and generalized urticaria. Only when the infection was eventually successfully eradicated using a combination of metronidazole and paromomycin, the women experienced symptom resolution.

There is a systematic review out just now in the well-esteemed journal "Allergy" on chronic spontaneous urticaria in patients with intestinal parasites. The approach is useful, interesting, and relevant. One of the main results, which was also highlighted in the abstract, is that patients with chronic urticaria more frequently have "Blastocystis hominis allele 34 (ST3)". This observation, however, pertains to one single study, and should be interpreted in this context. The original study was carried out by Rudolfo Daniel Casero and last-authored by a close colleague of mine, Juan David Ramirez, who currently does a lot to promote and improve molecular parasitology research in Latin America; among other things, he's a very successful and avid arranger of workshops. Anyway, the study included observations on Blastocystis in a group of Argentinean patients, who were stratified by the presence or absence of symptoms. Hence, there were four groups, reflecting 1) asymptomatic patients, 2) patients with chronic urticaria, 3) patients with non-specific gastrointestinal symptoms (NSGI), and 4) patients with both chronic urticaria and NSGI. No specific subtype was linked to any of the four groups; however, a very striking observation related to the distribution of ST3 strains across the groups: out of a total of 21 patients positive for ST3 allele 34 (the allele number is used to provide "genotype" information of the subtype), 18 had urticaria. On the other hand, out of 28 patients positive for ST3 allele 134, only 3 had urticaria.

ST3 allele 34 is probably the most common Blastocystis strain overall in many European countries; also in Asia (e.g. India), this genotype particularly common. Although common in South America too, it might not be the most common strain, given the data by Casero et al. These authors are the first to provide a clear association between a Blastocystis strain (i.e., on genotype level) and development of symptoms. Although the data warrant confirmation by prospective studies, the data should be food for thought.

About 20 papers are listed in PubMed on "Blastocystis AND urticaria". Last year, I was so fortunate to host Małgorzata Lepczynska in our lab for a couple of weeks. Incidentally, a review of the role of Blastocystis in the development of urticaria and first-authored by Lepczynska just emerged in PubMed. The authors try to explain the potential mecanisms underlying the development of Blastocystis-induced urticaria. For some reason, the authors did not include a study by Armentia et al. from 1993 (maybe due to the possibility that they had no access the paper?). Armentia presented a case series (n = 10) of Blastocystis patients who all had chronic urticaria; both the parasite and the symptom disappeared upon treatment with paromomycin sulfate.

I am not sure that the data available at this point are sufficient to generate inferences on the contributing role of Blastocystis in the development of urticaria; however, I would not hesitate to encourage dermatologists to look into the issues of "idiopathic chronic urticaria", with a view to clarifying the rate of Blastocystis colonisation among these patients and whether parasite eradication leads to symptom resolution. Such studies should also involve total analysis of the intestinal microbiota, both before and after treatment.

References:

Armentia A, Méndez J, Gómez A, Sanchís E, Fernández A, de la Fuente R, & Sánchez P (1993). Urticaria by Blastocystis hominis. Successful treatment with paromomycin. Allergologia et Immunopathologia, 21 (4), 149-51 PMID: 8237719   

Casero, R., Mongi, F., Sánchez, A., & Ramírez, J. (2015). Blastocystis and urticaria: Examination of subtypes and morphotypes in an unusual clinical manifestation Acta Tropica, 148, 156-161 DOI: 10.1016/j.actatropica.2015.05.004

Kolkhir P, Balakirski G, Merk HF, Olisova O, & Maurer M (2016). Chronic spontaneous urticaria and internal parasites - a systematic review. Allergy, 71 (3), 308-22 PMID: 26648083

Lepczyńska M, Chen WC, & Dzika E (2016). Mysterious chronic urticaria caused by Blastocystis spp.? International Journal of Dermatology, 55 (3), 259-66 PMID: 26469206 


Vogelberg C, Stensvold CR, Monecke S, Ditzen A, Stopsack K, Heinrich-Gräfe U, & Pöhlmann C (2010). Blastocystis sp. subtype 2 detection during recurrence of gastrointestinal and urticarial symptoms. Parasitology International, 59 (3), 469-71 PMID: 20363362 

Blastocystis: To Treat or Not to Treat...

This year, Coyle et al. published a Clinical Practice paper in Clinical Infectious Diseases, a journal with a 5-year impact factor of almost 8. It is still difficult to get papers on Blastocystis published in clinical, peer-reviewed journals of major impact, probably due to the fact that evidence of Blastocystis' pathogenicity is so far only indicative, so it is great to see that the authors have managed to get their manuscript past those iron doors!

A few issues have come to my attention. When reading the abstract the reader will get the impression that subtypes are synonymous with genotypes, which is not the case. In the case of Blastocystis, a subtype is equivalent to a species; one of the reasons why we haven't allocated species names to Blastocystis from humans, other mammals and birds yet, is that we do not have sufficient data on genetic diversity and host specificity to come up with relevant names.

It says in the first page (pdf) that Blastocystis subtype (ST) 3 is found only in humans, which is not true. This subtype is common in non-human primates and can be seen in other, larger animals, including dogs, and also birds, if I remember correctly. However, so far, we only have multilocus sequence typing data from human and non-human primates, and these data indicate that ST3 found in non-human primates is often different from ST3 found in humans.

The authors recommend that asymptomatic individuals with few cysts should not be treated. Then what about asymptomatic individuals with many cysts? Also, with the diagnostic short-comings of microscopy of faecal concentrates, the suggested cut-off at 5 organisms per visual field appears arbitrary and, in best case, fortuitous.

In the abstract, the authors state that metronidazole is the drug of choice, although they appear to be quite aware that this drug has limited effect in terms of eradicating Blastocystis. So, why is metronidazole the drug of choice? Blastocystis is a parasite lodged primarily in the large intestine, and therefore we must anticipate that metronidazole often fails to reach the the parasite in sufficient concentrations due to absorption proximally in the gut. Luminal agents, such as paromomycin, are probably more likely to work, maybe in combination with metronidazole, although we have had a case, where even this combination was not effective.

When reviewing studies of treatment, it is important to acknowledge that insensitive methods have been used to evaluate drug efficacy. Culture combined with PCR is in my opinion the best method available in this respect. I prefer adding culture to the test, since culture detects viable Blastocystis (as opposed to PCR which will detect both viable and non-viable cells). Future randomised controlled treatment studies should therefore use culture and PCR to identify carriers both pre- and post-treatment. Whether Blastocystis-positive stool post-treatment is due to recrudescence, resistance or reinfection is not easily evaluated, but some useful information can be achieved by multi-locus sequence typing of isolates pre- and post-treatment.

Literature cited:

Coyle CM, Varughese J, Weiss LM, & Tanowitz HB (2012). Blastocystis: to treat or not to treat... Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 54 (1), 105-10 PMID: 22075794  

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 12 (2), 263-73 PMID: 22116021  

Stensvold CR, Smith HV, Nagel R, Olsen KE, & Traub RJ (2010). Eradication of Blastocystis carriage with antimicrobials: reality or delusion? Journal of clinical gastroenterology, 44 (2), 85-90 PMID: 19834337

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:

1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.

2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!