This Month in Blastocystis Research (SEP 2014)

Before leaving for Venice and Padova to introduce Blastocystis to the XXX National Congress of The Italian Society of Protistology (ONLUS), allow me to kick in just a few words for the September issue of 'This Month in Blastocystis Research'.

I will highlight two papers.

The first is a study from the US (Yes, - US data! How rare is that?). The team investigated the prevalence and subtype distribution of Blastocystis among client-owned and shelter-resident cats and dogs. Studies of Blastocystis in companion animals are actually quite rare. The authors used nested PCR for detection, followed by sequencing of PCR products. Interestingly, Blastocystis was not detected in any of the >100 fecal samples from client-owned animals. By comparison, Blastocystis was detected in 10/103 (9.7%) shelter-resident canines, and 12/103 (11.65%) shelter-resident felines. There was no significant difference in Blastocystis spp. carriage rates between the shelter-resident dogs and cats. It is likely that differences in diet and other types of exposure account for Blastocystis being found in shelter-resident animals and not in domestic animals. As for cats and dogs, we don't really know much about what to expect subtype-wise. These animals harboured ST10 mostly, a subtype that has only been found in artiodactyls, NHPs, and lemurs, so far, and - taking these new data into account - with little apparent host preference.

Viktor - an avid fox hunter (in 2007).

Other subtypes included ST1 and one case of ST3, and one case of what was most likely a new subtype - maybe! But then, few animals were positive, and given the different data on subtypes in cats and dogs, it's much too early to speculate on host specific subtypes... for now, it appears that there are none, and that maybe cats and dogs are not really natural hosts? A study by Wang and colleagues identified a plethora of subtypes in dogs: Among 22 positive dogs, most of which were from India, ST1, ST2, ST4, ST5, and ST6 were found. Again, nested PCR was used, and I might have a slight concern that this type of PCR approach is so sensitive that it will pick up the smallest quantity of Blastocystis, maybe even dead Blastocystis or other stages of Blastocystis not necessarily colonising the host (contamination, etc.). But I don't know. The authors of the US study noted that Blastocystis was unlikely to be associated with disease of the animals and were unable to establish a reservoir for human colonisation/infection in these animals.

I never got around to checking Viktor (our cat, pictured above) for Blastocystis. Now it's too late.

I would like to move on to another study. This time the data is from a paper that has just appeared in press in Clinical Gastroenterology and Hepatology. We  analysed faecal DNAs from patients diagnosed with irritable bowel syndrome and healthy individuals. The reason for doing this was due to the fact that intestinal parasite have been speculated to play a role in the development of IBS, a disease affecting about 16% of the adult Danish population. And so we thought that the prevalence of common parasites such as Blastocystis and Dientamoeba fragilis might be higher in IBS patients than in healthy individuals. The study was led by Dr Laura R Krogsgaard, who took a quite unusual approach to collecting questionnaires and faecal samples, namely by collaborating with the company YouGov Zapera.  
We obtained faecal samples from 483 individuals, of whom 186 were cases – ie. patients with IBS – and 297 were healthy controls. DNA was extracted directly from the stool using the easyMag protocol, and the faecal DNAs were submitted to real-time PCR based screening for Blastocystis, Dientamoeba, Entamoeba histolytica and E. dispar, Cryptosporidium, and Giardia.

Above you see the results of the various analyses. Blue columns represent healthy individuals, and orange columns represent IBS patients. Fifty percent of the healthy controls were positive for one or more parasites, while this proportion was significantly lower in IBS patients, 36%. Also for each individual parasite, the number of positive cases was higher among controls than among patients with IBS. Dientamoeba was the most common parasite among healthy controls and IBS patients. In terms of Blastocystis subtypes, the distribution of subtypes between the two groups was non-significant (data not shown).We ended up by concluding that our findings indicated that these parasites are not likely to play a direct role in the pathogenesis of IBS. Longitudinal studies are required to understand their role in gastrointestinal health. 

Still, the role of Blastocystis in human health and disease remains ambiguous, although lots of interesting data is emerging. In order to try and understand the theories behind Blastocystis' potential able to generate disease, I would like to point the readers' attention to a new review, developed by Ivan Wawrzyniak and his prolific colleauges.

Ciao!

References

Krogsgaard LR, Engsbro AL, Stensvold CR, Vedel Nielsen H, & Bytzer P (2014). The Prevalence of Intestinal Parasites is not Greater Among Individuals with IBS: a Population-Based Case-Control Study. Clinical Gastroenterology and Hepatology : the official clinical practice journal of the American Gastroenterological Association PMID: 25229421

Krogsgaard LR, Engsbro AL, & Bytzer P (2013). The epidemiology of irritable bowel syndrome in Denmark. A population-based survey in adults ≤50 years of age. Scandinavian Journal of Gastroenterology, 48 (5), 523-9 PMID: 23506174

Ruaux CG, & Stang BV (2014). Prevalence of Blastocystis in Shelter-Resident and Client-Owned Companion Animals in the US Pacific Northwest. PloS One, 9 (9) PMID: 25226285  

Wang W, Cuttell L, Bielefeldt-Ohmann H, Inpankaew T, Owen H, & Traub RJ (2013). Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites & Vectors, 6 PMID: 23883734

Wawrzyniak I, Poirier P, Viscogliosi E, Dionigia M, Texier C, Delbac F, & Alaoui HE (2013). Blastocystis, an unrecognized parasite: an overview of pathogenesis and diagnosis. Therapeutic Advances in Infectious Disease, 1 (5), 167-78 PMID: 25165551 

Birds of America

Yesterday evening, I was watching another compelling BBC production, broadcast on Danish television: Earthflight, North America. In quite a unique way, the viewers got the rare opportunity to see through the eyes of birds such as eagles, geese, and pelicans and follow birds as they were migrating, escaping, hunting for prey, etc. It made me think of the 19th century masterpiece 'Birds of America' by John James Audubon, which can be viewed in the National History Museum in London. The book features 435 stunning hand-coloured plates that show birds life-size, in natural positions and in their natural habitat.

One of the things that I find interesting - and quite unexplored - is Blastocystis in birds. By 'unexplored' I mean that relatively little sampling has been done, and so the number of observations of Blastocystis in birds is still limited compared to other types of hosts. However, there is a brand new paper out in 'Infection, Genetics and Evolution' which includes observations on Blastocystis in birds (of America!).

You see, I was invited in on a study by colleagues in Colombia who had access to DNA from quite a few faecal samples from a number of host species, including feral birds, and what we found confirms the quite unambiguous trend seen so far: Birds - no matter where on this planet - appear to be colonised mainly by ST6 and ST7. As a matter of fact, in the present study only ST6 was seen in almost 50 Colombian passerine birds of varying species, most of which I believe are limited in geographical distribution to the Americas: Passer domesticus, Thraupis episcopus, Oryzoborus maximiliani, Sicalis flaveola, and Petrochelidon pyrrhonota. Moreover, only one allele of ST6, allele 122, was identified. Notably, the prevalence of Blastocystis in the sampled bird population was 90%. I believe that this is the first official report on Blastocystis in passeriformes. Other major groups of birds previously sampled include galliformes, anseriformes, and ratites (Stensvold et al., 2009; Alfellani et al., 2013).

Other subtypes have been reported in birds (Alfellani et al., 2013), but due to the very low number of samplings these subtypes may be more or less co-incidental/abberant findings. Of note, some samples from birds have been untypable. I have a slight recollection of detecting ST3 in Icelandic rock ptarmigans (in mixed ST infection) collected by Dr Karl Skírnission, but that certainly needs confirmation.

Bird contact/bird droppings - a significant source of Blastocystis in humans? Me feeding some 'Birds of Australia'. Photo by Dr Rebecca J Traub.

ST6 is very rarely seen in humans in Europe. In other parts of the world, for instance in Egypt and some Asian countries, ST6 appears relatively common, but we do not know much about 'bird subtypes' in those particular regions. Also, the situation in the US and Canada is more or less completely unknown (Blastocystis subtyping is something that appears not to attract research groups in North America apart from the one led by Dr Ron Fayer in Beltsville, Maryland).

ST7 is occasionally seen in humans in countries such as Sweden and Denmark. But in my - still limited - experience, individuals infected by these subtypes are not necessarily prone to 'suffer more' from intestinal symptoms than those who do not have these subtypes. While human cases of ST6 (and ST7) may represent cases of zoonotic transmission, it is far to early to draw any conclusions on this. It would be important to compare ST6 and ST7 18S alleles from humans and birds. MLST typing systems for these two subtypes are not yet available, but 18S analysis in itself may prove valuable for molecular epidemiological analyses as in the case of other subtypes (Stensvold et al., 2012).

Walton Ford: "Falling Bough" (Source). You will also see the now extinct Passenger Pigeon in 'Birds of America'.

References:

Ramírez JD, Sánchez LV, Bautista DC, Corredor AF, Flórez AC, & Stensvold CR (2013). Blastocystis subtypes detected in humans and animals from Colombia. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 23886615

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases, 12 (2), 263-73 PMID: 22116021

Stensvold CR, Alfellani MA, Nørskov-Lauritsen S, Prip K, Victory EL, Maddox C, Nielsen HV, & Clark CG (2009). Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. International Journal for Parasitology, 39 (4), 473-9 PMID: 18755193

This Month In Blastocystis Research (JUN 2013)

Another paper in the string of publications coming out from the PhD study by Dr Alfellani (London School of Hygiene and Tropical Medicine) has just appeared in PubMed.

Dr Alfellani and his colleagues have done a great job in analysing a multitude of samples from humans, non-human primates and animals; I have previously blogged about their observations from studies of human and non-human primates. Moreover, they have surveyed available data in order to better discuss their own findings, and the work has contributed significantly to what today is known about the host specificity, genetic diversity, phylogeography and general molecular epidemiology of Blastocystis.

Alfellani's most recent paper is published in the journal Protist, and it deals with the 'Genetic Diversity of Blastocystis in Livestock and Zoo Animals'.

It is quite a large paper which includes a lot of new information and a comprehensive (and hopefully exhaustive) table summarising Blastocystis subtype data in all relevant hosts (humans, non-human primates, other mammals and birds).

I will highlight a couple of things from the paper:

1. Apart from reporting on virtually complete SSU rDNA sequences from a couple of subtypes for which entire SSU rDNA sequences have yet not been available, we also report on three novel subtypes. Until recently, we only knew about 14 subtypes (ST1-ST14), of which ST1-ST9 can be found in humans. Now, three additional subtypes have been identified; ST15 in artiodactyls (camel and sheep) and non-human primates (chimpanzee and gibbon), ST16 in kangaroos, and ST17 in gundis.

The Gundi (Ctenodactylus gundi) is a rodent living mainly in the deserts of Northern Africa. (Source)

2. Novel data arising from analysis of faecal samples from humans and animals in Sebha, Libya, strongly indicate that humans and animals in this area are infected by different subtypes: Humans appear to carry ST1, ST2, and ST3, while synanthropic animals (artiodactyls in this case) mostly have ST5 and ST10 infections, suggesting that livestock is not a major contributor to human Blastocystis infection.

To this end, there is growing evidence of quite a substantial degree of host specificity of Blastocystis.  Even when subtypes overlap between humans and animals, we have accumulating evidence that the strains found in humans and animals are different. This means that the hypothesis that animals constitute an important reservoir of human Blastocystis infections currently has very limited support. It is my clear impression that when a strain of ST6 or ST8 is detected in humans, this strain has most probably been transmitted from an animal source. But we very rarely see these subtypes in humans, at least in Europeans.

It will be extremely interesting to see how the universe of Blastocystis subtypes unfolds... by genetically characterising strains in humans and non-human hosts, we are building up a clearer picture of transmission patterns and evolutionary biology, including our adaptation to Blastocystis, and the parasite's adaptation to us and other hosts.

It is noteworthy that we are starting to see different subtypes in rodents. We have previously thought that generally, rodents were infected by ST4. But now we know that many rodents are not infected, and we also know that rodents may harbour subtypes other than ST4.

So,17 subtypes of Blastocystis are now known. We have probably only seen the top of the iceberg, since many host species have not yet been sampled from, and it is likely that we will see quite a few STs being identified in the nearest future. To this end it is necessary to have a consensus regarding the identification of novel subtypes. Along with the Protist paper we have uploaded a supplementary file (Appendix A, TXT format) with aligned reference sequences that can be used for phylogenetic analysis,  hoping that it will be useful to our colleagues. In a future blog post I will try to address the issues of identifying new subtypes more specifically.

ST15 is one of the more interesting subtypes since it appears to have quite a low host specificity - infecting both non-human primates and artiodactyls. Yet, we have come across it only now. ST15 and ST17 are remarkable in the way that they appear to be closer related to herptile and arthropod lineages, respectively, than to lineages from mammals.

Please note that virtually complete sequences of ST10, ST13, ST14, ST15, and ST17 analysed in the study have been released in GenBank just now.

Further reading:

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic Diversity of Blastocystis in Livestock and Zoo Animals. Protist, 164 (4), 497-509 PMID: 23770574

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980

Alfellani MA, Jacob AS, Perea NO, Krecek RC, Taner-Mulla D, Verweij JJ, Levecke B, Tannich E, Clark CG, & Stensvold CR (2013). Diversity and distribution of Blastocystis sp. subtypes in non-human primates. Parasitology, 140 (8), 966-71 PMID: 23561720

Blastocystis in Non-Human Primates

If my recent blog post "Blastocystis aux Enfers" could be described as "Blastocystis meets Dante Alighieri", then this post might come across as "Blastocystis meets Sir David Attenborough" (with all due respect to both of these gentlemen!).

Non-human primates (NHPs) include apes (hominoids), Old World monkeys (cercopithecoids), New World Monkeys (ceboids) and prosimians such as lemurs. I have been so fortunate to be involved in a study of Blastocystis in NHPs; a study which was led by Dr Alfellani with several co-investigators, and which has just appeared online in the journal Parasitology (click here to be diverted to the the website - first view article section).

The study is the first of its kind aiming to provide a substantial insight into the host specificity of Blastocystis in NHPs and included subtype observations for 441 captive and free-living animals representing no less than 30 genera; most of the data were generated during the study, while sporadic observations from similar studies were also included.

It was a huge study with a lot of interesting information, and I will try and summarise some of the points here.

Apes such as bonobos, chimps, gorillas and orangutans were colonised by some of the most common subtypes in humans, namely ST1, ST2, and ST3, accounting for about 77% of the cases. Contrary to humans though, ST5 also appeared rather common, accounting for about almost 14% of the cases, and some of the gibbons studied had ST8. Interestingly, a chimp and a gibbon were found to be hosts of a new subtype, ST15.

Old World monkeys were studied to an even larger extent, and again, ST1, ST3 and ST2 predominated, accounting for about 95% of all cases of single subtype infection. Here ST5 was also seen (2%) but only in langurs/lutungs and vervet monkeys. Interestingly, ST8 was seen only in 1/226 cases. ST13 was found by colleagues in Tanzanian colobus monkeys (Petrasova et al., 2011), and 8% of the 226 cases represented mixed/unknown subtype infections.

Woolly monkey (Lagothrix lagotricha) (Source)

New World monkeys included in the study were mainly represented by woolly monkeys, and these were colonised first and foremost by ST8 (49%), but ST3, ST2, ST1 were also found. So was a single case of ST4, which in general appears to be surprisingly rare among NHPs.

A few observations on lemurs were included, and such animals appear to host a vast variety of subtypes with no particular predilection, hence ST1, ST2, ST4, ST8, ST10 and ST15.

Ring-tailed lemur (Lemur catta) (Source).

The most striking differences between humans and NHPs in terms of colonisation by Blastocystis subtypes is that humans are very rarely colonised by ST5, while this subtype appears common in apes and Old World monkeys. ST8 was seen only in arboreal apes and in woolly and howler monkeys, which are also tree-dwellers, and it is tempting to think that ST8 is found mainly in tree-dwelling NHPs; to my knowledge, ST8 has not been found in non-primate hosts, except for once in a bird. Human colonisation by ST8 has been demonstrated only very rarely, for instance in a Danish woman returning from holiday in Indonesia and in animal keepers. Conversely, ST4 is seen extremely rarely in NHPs, while very common in humans in some parts of the world, apparently especially in Europe. These clear discrepancies in subtype distribution in humans and NHPs may boil down to host specificity and/or apparent geographically restricted range of some subtypes.

Another striking observation was that cryptic host specificity exists in ST1 and ST3, meaning that ST1 and ST3 strains found in NHPs overall differ genetically from strains found in humans belonging to the same subtypes, adding support to our previous findings.This suggests that humans are generally colonised by other strains than those found in NHPs. It will be interesting to see, whether other types of hosts sharing these subtypes carry distinct, host-specific strains. While MLST is probably the best way of testing for this, a lot of information can be obtained simply by barcoding. Pets, for instance, may share subtypes seen in humans, and so barcoding of "pet blasto" may be one of the very interesting pathways to knowledge.

We found no evidence of those subtypes that we have nicknamed "avian subtypes", namely ST6 and ST7. In some parts of the world, these two subtypes do not appear uncommon in humans; in Denmark and Sweden, for instance, ST7 is seen on quite a few occasions. But, interestingly, both STs are apparently absent in NHPs.

Langurs - the front cover of one of my favourite books showcasing works by the magnificent Walton Ford.

Incidentally, there is a sequence in GenBank from a gorilla (JX159284) which possibly represents a novel subtype, which is related to reptilian Blastocystis, and so it appears that the host spectrum and diversity of Blastocystis in NHPs continues to unfold.

A recent study saw that faecal microbiomes of wild non-human primates co-vary with host species, hence reflecting host phylogeny. This was evidenced by higher intra-species similarity among wild primate species, which may reflect species specificity of the microbiome in addition to dietary influences. This may in part explain the differences in Blastocystis subtypes seen in different NHP host species, but it is also possible that differences in subtypes reflect differences in habitat (and thereby possibly exposure) or geographical differences in subtype distribution. Indeed Homo sapiens is host to a variety of subtypes, and while ST4 is common in Europe, it appears virtually absent in many other parts of the world. Likewise, the differences in the prevalence of ST8 may reflect differences in geographical distribution, habitat and diet (arboreal vs. ground) as well differences in host specificity.

The overall interesting thing here is the schism of exposure vs. host specificity.


Suggested reading:

Alfellani, M., Jacob, A., Perea, N., Krecek, R., Taner-Mulla, D., Verweij, J., Levecke, B., Tannich, E., Clark, C., & Stensvold, C. (2013). Diversity and distribution of Blastocystis sp. subtypes in non-human primates Parasitology, 1-6 DOI: 10.1017/S0031182013000255

Yildirim S, Yeoman CJ, Sipos M, Torralba M, Wilson BA, Goldberg TL, Stumpf RM, Leigh SR, White BA, & Nelson KE (2010). Characterization of the fecal microbiome from non-human wild primates reveals species specific microbial communities. PloS one, 5 (11) PMID: 21103066

Stensvold CR, Arendrup MC, Nielsen HV, Bada A, & Thorsen S (2008). Symptomatic infection with Blastocystis sp. subtype 8 successfully treated with trimethoprim-sulfamethoxazole. Annals of tropical medicine and parasitology, 102 (3), 271-4 PMID: 18348782

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 12 (2), 263-73 PMID: 22116021

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!