Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!