This Month in Blastocystis Research (FEB 2015)

Before heading off to visit dear colleagues at the Public Health Agency of Sweden tomorrow morning, I thought I'd do a quick 'This Month...' post.

Tropical Parasitology has published a paper by Elghareeb and colleagues on  'Laboratory Diagnosis of Blastocystis in Diarrheic Patients'. I was asked to do a Guest Commentary on their paper, and if your're interested you can download my comments here for free (html version). The paper by Elghareeb et al. should also be free for download at the website.

I have been very lucky to work together with Dr Prashant K Pandey and his colleauges in Pune, India. Together we just published the first data on Blastocystis subtypes ever to appear in India for what I know. We subtyped Blastocystis in a cohort of healthy Indian individuals, and found ST1 and ST3 in 27/100 adult individuals tested, while other common subtypes, ST2 and ST4, were absent. Remarkably, ST3 was seen in all positive individuals, while ST1 was seen only in mixed infections. The strains (alleles) found in India were no different to those found in for instance Europe.

There is a paper out by Rossen and colleagues from The Netherlands showing that Blastocystis is relatively uncommon in patients with active ulcerative colitis (UC) and significantly less common in UC patients (13.3%) than in healthy individuals (32.5%). This is completely in line with data that we generated in Denmark a couple of years ago. In fact, at two separate occasions we have been able to look into patients with inflammatory bowel disease. In both cases (one study has been submitted for publication), hardly any Blastocystis was found in patients with Crohn's disease, while a few patients with UC were positive; however, mostly patients with inactive disease appeared to have Blastocystis, while those with flare-ups were negative. Therefore, the influence of dysbiosis on Blastocystis colonisation should be subject to further scrutiny.

A lot of action goes on at the official website for the 1st International Blastocystis Symposium in Ankara in May, with exactly three months to go! Why not take a minute to browse the programme for the Pre-Symposium Course and the Scientific Programme for the actual Symposium? Please go here to familiarise yourself with the new content. 
Also, conference abstracts are pouring in, - did you submit yours yet?

References

Elghareeb AS, Younis MS, El Fakahany AF, Nagaty IM, & Nagib MM (2015). Laboratory diagnosis of Blastocystis spp. in diarrheic patients. Tropical Parasitology, 5 (1), 36-41 PMID: 25709951

Stensvold, C. (2015). Laboratory diagnosis of Blastocystis spp Tropical Parasitology, 5 (1) DOI: 10.4103/2229-5070.149885  

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 25701123

Rossen NG, Bart A, Verhaar N, van Nood E, Kootte R, de Groot PF, D'Haens GR, Ponsioen CY, & van Gool T (2015). Low prevalence of Blastocystis sp. in active ulcerative colitis patients. European Journal of Clinical Microbiology & Infectious Diseases: Official Publication of the European Society of Clinical Microbiology PMID: 25680316

This Month in Blastocystis Research (AUG 2014)

Some August highlights in Blastocystis research:

1) The PRE-IOPCA Molecular Parasitology Workshop took place from the 7-10 August at CINVESTAV, Mexico City. Top-motivated students from some 10-15 countries worked hard from 7 am to 7 pm in dry+wet lab sessions, and we all had a really great time, thanks to both participants and fantastic organisers. There was a 4 h session on Blastocystis molecular epidemiology, and I was pleased to learn that some of the participants currently work with (or plan to work with) Blastocystis. I look forward to doing something similar in Ankara, Turkey on the 27th of May next year (www.blastomeeting2015.com - did you bookmark it?).

Most of the task force of the Molecular Parasitology Workshop (ICOPA 2014).

2) At the actual ICOPA conference, I chaired a session on Blastocystis in the context of IBS, with talks delivered by Ken Boorom, Pablo Maravilla, Pauline Scanlan and myself. In the audience I was honoured to see and meet Dr Hisao Yoshikawa, who has been a main contributor to Blastocystis research over the past 25 years or so (you can look up the publications by Dr Yoshikawa here). Considering the focus of this post, I guess that Pauline's talk was of particular interest, since she presented the data that we just published in FEMS Microbiology and Ecology:

3) The microbial eukaryote Blastocystis is a prevalent and diverse member of the healthy human gut microbiota. That's the title of the paper appearing in FEMS Microbiology and Ecology. The study, led by Pauline, showed that Blastocystis was present in 56% of 105 healthy adults, which is much higher than previously reported from an industrialised county (Ireland). Moreover, a diversity of different subtypes (species) were detected and Blastocystis was present in a subset of individuals sampled over a period of time between six and ten years, indicating that it is capable of long-term host colonisation. These observations show that Blastocystis is a common and diverse member of the healthy gut microbiota, thereby extending our knowledge of the microbial ecology of the healthy human intestine. And one of the interesting things here is: Why do we see this great divide? Why does half of the population appear colonised while the other half not? What are the factors driving successful Blastocystis colonisation? Would some people be refractory to colonisation or does it really boil down to some sort of enterotype-driven phenomenon as previously indicated?

4) I would like to reiterate the paper by Klimes et al. published a study in Genome Biology and Evolution (GBE) on a striking finding in the Blastocystis nuclear genome. Stop codons created by mRNA polyadenylation have been seen so far in mitochondrial genomes only and not in nuclear genomes; however, the authors observered this feature in Blastocystis's nuclear genome. Partly due to limitations of currently available annotation software, this finding ostensibly calls for reannotation of the genome currently available in GenBank (ST7). The paper was highlighted in a separate article in GBE that can be accessed from here.

5) Speaking of Blastocystis genomes: The genome of Blastocystis ST4 (WR1 strain) is now available on-line and can be accessed here.

6) Wang and colleagues studied the location and pathogenic potential of Blastocystis in the porcine intestine. They studied a total of 28 pigs from a commercial piggery, a small animal farm, and a research facility, and all pigs were positive (for ST5, and mixed subtypes were also seen in some). Post-mortem analyses showed that all pigs were consistently found to harbour Blastocystis in the colon, and approximately 90% of the caeca and rectums examined were positive. Some of the pigs were immunosuppresed (Dexamethasone), and interestingly, Blastocystis was occasionally detected in the small intestine, notably in immunosuppressed pigs, suggesting that immunosuprression may alter host-agent relations and predispose to small intestinal colonisation. Histopathological analysis saw the presence of vacuolar and granular forms of Blastocystis, but there was no evidence of attachment or invasion of the intestinal epithelium. The lack of pathology, including inflammation, epithelial damage, mucosal sloughing, and lamina propria oedema, confirmed the trend from a previous study carried out by Ron Fayer's group (see reference below). The study adds to the string of papers finding no evidence in support for Blastocystis causing primary intestinal damage.

6) Lastly, I want to extend a cordial thank you to Shashiraja Padukone and Subhash Chandra Parija, Department of Microbiology, Jipmer, Puducherry, India, for writing up a review of my 'Thoughts on Blastocystis' available on Amazon for the price of only one US$ or so. The review was published recently in Tropical Parasitology and can be accessed here.

And, for those who are worried about researchers 'overselling' microbiome research, there is a small comment in Nature calling for sound scepticism to be applied to research dealing with the relationship between the microbiome and different types of diseases. There is much to be agreed upon, and what I find particularly important, is to take the reductionist approach where possible - in terms of Blastocystis there are lots of ways to study the impact of Blastocystis on bacteria in vitro, and also host microbiota, physiology and immunology in vivo; ways that can be controlled quite diligently. Also, I think that simple validation of methods applied to map e.g. intestinal microbiota is key. This is for some reason something that is generally being utterly and completely ignored. Why?

References 

Fayer R, Elsasser T, Gould R, Solano G, Urban J Jr, & Santin M (2014). Blastocystis tropism in the pig intestine. Parasitology Research, 113 (4), 1465-72 PMID: 24535732

Hanage, W. (2014). Microbiology: Microbiome science needs a healthy dose of scepticism Nature, 512 (7514), 247-248 DOI: 10.1038/512247a

Klimeš V, Gentekaki E, Roger AJ, & Eliáš M (2014). A large number of nuclear genes in the human parasite blastocystis require mRNA polyadenylation to create functional termination codons. Genome Biology and Evolution, 6 (8), 1956-61 PMID: 25015079

Scanlan PD, Stensvold CR, Rajilić-Stojanović M, Heilig HG, De Vos WM, O'Toole PW, & Cotter PD (2014). The microbial eukaryote Blastocystis is a prevalent and diverse member of the healthy human gut microbiota. FEMS Microbiology Ecology PMID: 25077936 

Venton, D. (2014). Highlight: Not Like a Textbook--Nuclear Genes in Blastocystis Use mRNA Polyadenylation for Stop Codons Genome Biology and Evolution, 6 (8), 1962-1963 DOI: 10.1093/gbe/evu167

Wang W, Bielefeldt-Ohmann H, Traub RJ, Cuttell L, & Owen H (2014). Location and pathogenic potential of Blastocystis in the porcine intestine. PloS One, 9 (8) PMID: 25093578 

This Month In Blastocystis Research (AUG 2013)

Quite a few papers relevant to Blastocystis research have made it to PubMed over the past month! Therefore, the August version of 'This Month in Blastocystis Research' is more like a list of papers + short descriptions/comments, rather than one or two actual paper reviews.

Dr Aldert Bart and his Dutch colleagues have published a study that confirms data emerging from other parts of Europe. Using microscopy (fixed faecal smears) and PCR, they found an almost 40% prevalence of Blastocystis in returning travelers with symptoms, and a prevalence of 18% in patients referred for other reasons. The distribution of subtypes found in the study population was quite similar to what has been found elsewhere in Europe with ST3 predominating (42%) and the rest of the subtypes attributable to ST1 (22%), ST2 (22%), ST4 (12%), ST6 (1%) and ST7 (1%).

The Tropical Parasitology theme issue on Blastocystis has now gone live. You’ll find a link to the editorial and the three papers included in the symposium here.

In my previous post I referred to a new study from Colombia which includes subtyping of Blastocystis isolates from humans, and a variety of animals, including birds. The paper is interesting for a number of reasons, but first and foremost it confirms the virtual absence of ST4 in humans in S America. Moreover, the study included 70 Blastocystis positive samples from asymptomatic carriers, 40 positive samples from patients with diarrhoea, and 15 positive samples form patients with IBS. Remarkably, all samples from healthy carriers were typed as ST1, those from patients with diarrhoea belonged to ST2, and those from IBS patients to ST3. Such a clear-cut distribution of subtypes across cohorts is unprecedented and of course warrants confirmation and further investigation. In Europe, ST4 is very common in humans, while it appears rare in humans in many other parts of the world. ST4 also appears rare among non-human primates (NHPs), our closest living relatives, and while NPHs and humans otherwise tend to share the same major subtypes (ST1, ST2, and ST3), this suggests that while subtypes 1, 2 and 3 have probably co-evolved with primates, ST4 has only recently entered the primate population with a preference for humans! I have hinted at this many times by now, but I find it extremely interesting which is why I keep repeating it.

There is a paper out by Santos and Rivera from the Philippines comparing microscopy of direct faecal smear with culture and PCR for detection of Blastocystis. They ended up concluding that culture was the best diagnostic modality, but it should be noted that the PCR used in the study targets a 1.8 kbp product (complete SSU rRNA gene!), and much smaller products are usually targeted in diagnostic PCR assays. The Blastocystis real-time PCR developed by me and my colleagues targets a sequence stretch of ~120 bp, securing optimum test sensitivity. The results of the Philippine study should be interpreted with this in mind.

Li et al., have published data on experimental infection of ST1 in Sprague-Dawley rats. Animals belonging to this species appeared susceptible to a ST1 strain isolated from a diarrhoeic patient that had been kept in culture and for which induction of cysts had been performed with a view to infecting the rats. The study confirms that Blastocystis is mainly a parasite of the coecum and colon. The authors found evidence of Blastocystis invasion into the lamina propria in one of the animals, and signs of inflammation in all animals challenged. While it is great to see that experimental models can be sustained and that encystation can be induced in vitro, at least two important factors must be kept in mind to fully comprehend the study: Although cysts were isolated by gradient centrifugation prior to inoculation, it is unlikely that all bacteria have been removed from cyst suspensions; in other words, the cyst preparation is not likely to be 'sterile', and any effect of the potentially accompanying bacterial flora is difficult to determine. Moreover, rats may not be natural hosts of ST1 (very few data available on the topic!), and so, the pathology caused in the rats may be an unlikely finding in humans, who are indeed natural hosts of ST1 and may have developed a high degree of tolerance to this subtype.

Are dogs, wolves, and other canids natural hosts of Blastocystis?

When visiting Australia earlier this month, I had the pleasure of meeting Wenqi Wang and Tawin Inpankaew, both PhD students working at School of Veterinary Science, The University of Queensland Gatton Campus and supervised by Dr Rebecca Traub. One of the foci of this group is to study Blastocystis in animals, for instance in households where animals are kept as pets. Recently, a paper emerged from this group on diversity of Blastocystis subtypes in dogs in different geographical settings, hence domestic/pound dogs from Brisbane, Australia, semi-domesticated dogs from a village in Cambodia, and stray dogs from Mumbai and other Indian cities. Using sensitive PCR methods they observed that almost one fourth of the Indian dogs were infected, while dogs in the Cambodian village and in Queensland remained largely uninfected. Coprophagy and access to Blastocystis-positive stool from different hosts may account for the relatively high prevalence in stray dogs in India, although one might assume that the prevalence would then be even much higher? The team used nested PCR in their study and found four different subtypes in the Indian dogs, including ST1, ST4, ST5 and ST6. Whether all of their data collectively indicate that dogs are not natural hosts of Blastocystis is a matter of debate and remains to be more thoroughly investigated. Indeed, prevalence and subtype data from studies of samples from wild life canids (dingos, jackals, wolves, coyotes, but also foxes and raccoon dogs) would shed further light on this topic.

Finally, for those interested in how Blastocystis deals with oxidative stress and related metabolic issues, there is a paper out on iron-sulphur cluster biogenesis in protozoan parasites by Ali and Nozaki citing works by Tsaousis (2012), Denoeud (2011), Long (2011), and Stechmann (2008).

Literature:

Ali V, & Nozaki T (2013). Iron-sulphur clusters, their biosynthesis, and biological functions in protozoan parasites. Advances in Parasitology, 83, 1-92 PMID: 23876871

Bart A, Wentink-Bonnema EM, Gilis H, Verhaar N, Wassenaar CJ, van Vugt M, Goorhuis A, van Gool T. Diagnosis and subtype analysis of Blastocystis sp. in patients in a hospital setting in the Netherlands. BMC Infectious Diseases, 13:289.

Li J, Deng T, Li X, Cao G, Li X, & Yan Y (2013). A rat model to study Blastocytis subtype 1 infections. Parasitology Research PMID: 23892480 DOI: 10.1007/s00436-013-3536-7

Parija SC (2013). Blastocystis: Status of its pathogenicity. Tropical Parasitology, 3 (1) PMID: 23961433

Parija SC, & Jeremiah S (2013). Blastocystis: Taxonomy, biology and virulence. Tropical Parasitology, 3 (1), 17-25 PMID: 23961437 

Ramírez JD, Sánchez LV, Bautista DC, Corredor AF, Flórez AC, & Stensvold CR (2013). Blastocystis subtypes detected in humans and animals from Colombia. Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 23886615

Sekar U, & Shanthi M (2013). Blastocystis: Consensus of treatment and controversies. Tropical Parasitology, 3 (1), 35-9 PMID: 23961439

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438  

Wang W, Cuttell L, Bielefeldt-Ohmann H, Inpankaew T, Owen H, & Traub RJ (2013). Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites & Vectors, 6 PMID: 23883734

Where Are We On Blastocystis Subtypes?

As mentioned, Blastocystis exhibits remarkable intrageneric diversity, which is continuously being explored by us and our colleagues. We are convinced that the genus of Blastocystis comprises multiple species, but for now we call them "ribosomal lineages" or "subtypes" and allocate numbers to each subtype, hence ST1, ST2, etc. While the number of subtypes that can be found in humans remains stable, we and our colleagues are still expanding the subtype universe in non-human hosts (I will be blogging on this shortly).

Barcoding currently represents state-of-the-art in Blastocystis subtyping, and luckily this method appears to gain a foothold in labs across the world.

Nine subtypes have been found in humans, but some of them only on rare occasions. A recent study going out from London School of Hygiene and Tropical Medicine and led by Dr Alfellani and published just now in Acta Tropica looked at 356 Blastocystis sequences from samples from the UK and Libya, but also from sub-Saharan Africa, namely Liberia and Nigeria.

Blastocystis Facts Sheet

I've tried to summarise a few facts here:

• Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
• The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
• Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
• Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
• Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
• Most carriers do probably not experience more intestinal symptoms than the average individual.
• We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
•  ST3 is probably the most common subtype in humans.
• ST4 may be more much more common in Europe than outside Europe. 
• ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
• Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.

·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:

1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.

2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.