This Month in Blastocystis Research (FEB 2016) - Rash Edition

A couple of years ago, I contributed to writing up a Case Report on what appeared to be Blastocystis-associated urticaria (hives). Receiving various courses of ineffective antibiotic treatment with a view to eradicating Blastocystis, a woman continued to suffer from gastrointestinal symptoms and generalized urticaria. Only when the infection was eventually successfully eradicated using a combination of metronidazole and paromomycin, the women experienced symptom resolution.

There is a systematic review out just now in the well-esteemed journal "Allergy" on chronic spontaneous urticaria in patients with intestinal parasites. The approach is useful, interesting, and relevant. One of the main results, which was also highlighted in the abstract, is that patients with chronic urticaria more frequently have "Blastocystis hominis allele 34 (ST3)". This observation, however, pertains to one single study, and should be interpreted in this context. The original study was carried out by Rudolfo Daniel Casero and last-authored by a close colleague of mine, Juan David Ramirez, who currently does a lot to promote and improve molecular parasitology research in Latin America; among other things, he's a very successful and avid arranger of workshops. Anyway, the study included observations on Blastocystis in a group of Argentinean patients, who were stratified by the presence or absence of symptoms. Hence, there were four groups, reflecting 1) asymptomatic patients, 2) patients with chronic urticaria, 3) patients with non-specific gastrointestinal symptoms (NSGI), and 4) patients with both chronic urticaria and NSGI. No specific subtype was linked to any of the four groups; however, a very striking observation related to the distribution of ST3 strains across the groups: out of a total of 21 patients positive for ST3 allele 34 (the allele number is used to provide "genotype" information of the subtype), 18 had urticaria. On the other hand, out of 28 patients positive for ST3 allele 134, only 3 had urticaria.

ST3 allele 34 is probably the most common Blastocystis strain overall in many European countries; also in Asia (e.g. India), this genotype particularly common. Although common in South America too, it might not be the most common strain, given the data by Casero et al. These authors are the first to provide a clear association between a Blastocystis strain (i.e., on genotype level) and development of symptoms. Although the data warrant confirmation by prospective studies, the data should be food for thought.

About 20 papers are listed in PubMed on "Blastocystis AND urticaria". Last year, I was so fortunate to host Małgorzata Lepczynska in our lab for a couple of weeks. Incidentally, a review of the role of Blastocystis in the development of urticaria and first-authored by Lepczynska just emerged in PubMed. The authors try to explain the potential mecanisms underlying the development of Blastocystis-induced urticaria. For some reason, the authors did not include a study by Armentia et al. from 1993 (maybe due to the possibility that they had no access the paper?). Armentia presented a case series (n = 10) of Blastocystis patients who all had chronic urticaria; both the parasite and the symptom disappeared upon treatment with paromomycin sulfate.

I am not sure that the data available at this point are sufficient to generate inferences on the contributing role of Blastocystis in the development of urticaria; however, I would not hesitate to encourage dermatologists to look into the issues of "idiopathic chronic urticaria", with a view to clarifying the rate of Blastocystis colonisation among these patients and whether parasite eradication leads to symptom resolution. Such studies should also involve total analysis of the intestinal microbiota, both before and after treatment.

References:

Armentia A, Méndez J, Gómez A, Sanchís E, Fernández A, de la Fuente R, & Sánchez P (1993). Urticaria by Blastocystis hominis. Successful treatment with paromomycin. Allergologia et Immunopathologia, 21 (4), 149-51 PMID: 8237719   

Casero, R., Mongi, F., Sánchez, A., & Ramírez, J. (2015). Blastocystis and urticaria: Examination of subtypes and morphotypes in an unusual clinical manifestation Acta Tropica, 148, 156-161 DOI: 10.1016/j.actatropica.2015.05.004

Kolkhir P, Balakirski G, Merk HF, Olisova O, & Maurer M (2016). Chronic spontaneous urticaria and internal parasites - a systematic review. Allergy, 71 (3), 308-22 PMID: 26648083

Lepczyńska M, Chen WC, & Dzika E (2016). Mysterious chronic urticaria caused by Blastocystis spp.? International Journal of Dermatology, 55 (3), 259-66 PMID: 26469206 


Vogelberg C, Stensvold CR, Monecke S, Ditzen A, Stopsack K, Heinrich-Gräfe U, & Pöhlmann C (2010). Blastocystis sp. subtype 2 detection during recurrence of gastrointestinal and urticarial symptoms. Parasitology International, 59 (3), 469-71 PMID: 20363362 

Blastocystis Facts Sheet

I've tried to summarise a few facts here:

• Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
• The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
• Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
• Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
• Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
• Most carriers do probably not experience more intestinal symptoms than the average individual.
• We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
•  ST3 is probably the most common subtype in humans.
• ST4 may be more much more common in Europe than outside Europe. 
• ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
• Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.

·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:

1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.

2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.