Is this a new Blastocystis subtype? Maybe not! Here's Why!

The genetic diversity of Blastocystis is becoming comparable to the universe! Seventeen subtypes (which are likely separate species or even genera) have been acknowledged so far, but quite a few more have been mentioned.

However, before assigning new Blastocystis subtype numbers to your SSU rDNA sequences, you'd need to do some QC work on your data. Sometimes we notice sequences deposited in the NCBI Database or included in articles that may look like new Blastocystis subtypes.... but they're most likely not!

I asked Prof Graham Clark from London School of Hygiene and Tropical Medicine, who has more than 20 years' experience in the Blasto business, to give a couple of examples, explaining where issues may arise. He says:

'One of the tasks I do when I have a few minutes to spare is to look at new Blastocystis sequences that have been deposited into GenBank. I am always hoping to stumble across some exciting new subtypes or new hosts that will expand our understanding of diversity in Blastocystis. Only rarely does this happen, however. I do, occasionally, come across sequences that are problematic and it is these that I want to focus on.

Chimaeras: This problem occurs during PCR amplification when one primer binds to a Blastocystis subtype DNA and the other primer binds to a different source of DNA. In the first case I came across the other source was a different Blastocystis subtype, meaning that the sequence at one end of the PCR product matched one subtype and the sequence at the other end matched a different subtype. This observation is mentioned in the paper describing barcoding of Blastocystis (Scicluna et al, 2006). Since then I have seen other chimaeric sequences: one recently was a mixture of Blastocystis plus a plant while another was Blastocystis plus a free-living protist.

Chimaeras are produced when there is incomplete replication of a DNA strand during a cycle. After denaturation in the next cycle, the single stranded partial product can bind to another single stranded product from a different source and synthesis results in a product combining sequences from two sources. The conservation of ribosomal RNA genes means there can be sufficient similarity to allow binding between sequences from distantly related organisms.

Chimaeras are generally only found when the sequences are from cloned ribosomal RNA gene sequences obtained by PCR, although they also occur in some forms of Next Generation  Sequencing. When mixed PCR products are sequenced directly the sequence obtained is the average of all the products in that reaction, and so chimaera sequences will usually be ‘diluted out’ by the major product of the reaction. Only when a single sequence from that mixture is isolated and studied will chimaeras be detected.

If the ‘alien’ region makes up a significant percentage of the sequence then the result of BLAST analysis will show a percentage divergence from known subtypes that indicates it may represent a new subtype. A quick way to evaluate this is to compare the BLAST results using the first and last thirds of the sequence. If it is a new subtype the results should be similar. In a recently detected chimaera, the first third was a 100% match to a known Blastocystis subtype while the last third was a 95% match to asparagus. This approach is an easy way to check whether there is something to get excited about.

A chimaera sequence can sometimes be detected because of its impact on phylogenetic trees. The sequence will be on its own branch, often at the base of a clade containing the subtype found at the Blastocystis-matching end.

Non-Blastocystis Blastocystis sequences: Like chimaeras these are often PCR artefacts, most commonly encountered when amplifying from stool DNA, especially if the stool is non-human. There is an expectation that Blastocystis-specific primers will only amplify Blastocystis DNA but, sadly, that is not always the case. I have personally seen this many times - if Blastocystis DNA is a minority of the eukaryotic DNA in the sample then the likelihood of artefacts increases greatly. These are generally identified easily if the sequence is compared using BLAST against the full nr/nt nucleotide collection in GenBank. However, there is a temptation to limit the search to the genus Blastocystis to speed up the identification process, because that is what you expect it to be. Again because of the conservation of ribosomal RNA genes, if ribosomal RNA genes are amplified there will be a match to Blastocystis, and the divergence will likely suggest, again, a new subtype.  Comparing against the full nucleotide collection will always show whether the sequence is of Blastocystis origin.

Both chimaeras and non-Blastocystis products are easily identified if the correct steps are taken. In conclusion, be suspicious of anything that is significantly divergent to known Blastocystis – it could be an indication of an artefact.'

Fig. 1. A 'Blastaragus' (a chimaera of a Blastocystis and an asparagus)

Fig. 2. An example of a chimaeric DNA sequence (the 'Blastaragus' from Fig. 1). Notice how the consensus sequence starts out as Blastocystis ST14, shifts to asparagus, and then shifts back again to Blastocystis ST14.

I thank Graham, and I really hope that this information will be picked up by many of our colleageus. And please share! Research into Blastocystis is rapdily expanding, and we should all take on the responsibility of QCing our data.

Thanks for listening!

By the way... if you're interested in tutorials on Blastocystis subtyping from our recent workshop in Colombia, please look up Workshop Session 4 in the manual available at this link. 

Hope to be back before Christmas!

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.

The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC

What you'll see is this:

As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:

For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).

Using STADEN for Sequence Assembly by RuneStensvold

When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

Is This A New Subtype?

To quote one of my colleagues attending the recent IWOP 2012 meeting in Tarrytown, NY, Blastocystis subtyping in humans and animals is becoming 'trendy', and so we keep trying to advocate for a standardisation of the metholodology of Blastocystis subtyping.

We recently changed the title of our page at www.pubmlst.org/blastocystis so that now it is called Blastocystis Subtype (18S) and Sequence Typing (MLST) Databases, and we added some text to front page:

In terms of genetic markers, the barcode region (Scicluna et al., 2006) is by far the best represented in publicly available sequence databases, and the correct subtype can be identified by BLAST analysis in the sequence database at the present site. Blasting against this database has the added advantages, compared to using GenBank, of automatically assigning allele types to the SSU-rDNA as well as using the consensus subtype nomenclature (unlike GenBank where the subtype is included only if one was part of the accession submission and no attempt to impose a standard nomenclature is made). In case the sequence does not match any of the ones in the database despite full coverage of the region, this indicates that the sequence represents a new allele or maybe even a new subtype depending on the amount of variation. If a new subtype is suspected, we suggest doing PCR and sequencing of the complete SSU rRNA gene with subsequent phylogenetic analysis using reference sequences.

Now, the last bit is extremely important. We have seen examples of researchers (including ourselves!) assigning sequences to a new a subtype in the absence of complete SSU rDNA data (in fact complete sequences for ST10-ST14 are not yet publicly available!). Doing so has a least two major limitations/drawbacks: Far from all SSU rDNA regions have been validated as being representative of the whole SSU rRNA gene in terms of phylogenetic analysis, and therefore phylogenetic inferences based on non-validated regions may have little or at least less support than anticipated. Moreover, if someone analyses e.g. position 600-1600, and phylogenetic analysis based on this region reveals a potentially new subtype, this makes it impossible for his/her colleague who has data covering positions 1-600 from a Blastocystis isolate that may also represent a new subtype to ascertain whether it might be same subtype (see example below)!

Obtaining complete SSU rDNA sequences directly from faecal DNA may be a cumbersome task but is sometimes possible by combining sequence-specific primers with low-specificity primers such as the RD5 and the RD3 primers (Clark, 1997). If a cultured isolate is available, obviously this makes complete SSU rDNA sequencing much easier.

While it appears that the number of subtypes occurring in humans stays around 9, our gut feeling is that we are yet to uncover quite a few subtypes colonising non-human mammals, and it's great to see an increasing number of teams exploring the genetic diversity of Blastocystis. For instance, Dr Ronald Fayer and his group recently published exciting data on a new Blastocystis subtype in cattle, which they named ST14 (Fayer et al., 2012).

Importantly, caution should be taken to avoid creating confusion in subtype terminology. Confusion can arise when independent researchers assign the same new subtype name (e.g. ST14, ST15, etc.) to novel sequences which in fact belong to different ribosomal lineages, or when incomplete SSU rDNA sequence data are used; this situation was seen recently, when Petrasova et al. (2011), assigned a Colobus sequence to ST5, although it was in fact a ST13 sequence (Clark et al., in press); the situation arose, since Petrasova et al. (2011) did not have data covering the region currently available for ST13 (Parkar et al., 2010), and therefore believed that their sequence was a unique ST5 variant. As for ST14, less than 500 bp are currently available, and these 500 bp are not in the barcode region, making it difficult for all teams using barcoding to compare their data. And so we would like to advocate for making complete SSU rDNA sequences publicly available (Genbank) for potentially new subtypes, for at least two reasons:

1. Phylogenetic inferences based on the complete SSU rDNA will be more robust than those obtained from analysing shorter sequence streches.

2. Complete seqeunces are needed for reference since subtype screening typically includes a single round PCR such as barcoding (Scicluna et al., 2006) amplifying about 550 bp; in the situation where complete SSU rDNAs are available for all known subtypes, it will be quick to analyse, whether a sequence may represent a new subtype, since this will be independent on the SSU rDNA region studied.We therefore hope that complete SSU rDNA sequences will soon be made publicly available for ST10-ST14.

So, when does a complete SSU rDNA sequence represent a new subtype? Well, we have a review paper in press in Advances in Parasitology on recent developments in Blastocystis research, which will be published in less than six months probably, and which also touches on this topic; once the paper is published, I will try and make a summary our thoughts on this...

Further reading:

Clark CG (1997). Extensive genetic diversity in Blastocystis hominis. Molecular and biochemical parasitology, 87 (1), 79-83 PMID: 9233675

Fayer R, Santin M, & Macarisin D (2012). Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitology research PMID: 22710524

Parkar U, Traub RJ, Vitali S, Elliot A, Levecke B, Robertson I, Geurden T, Steele J, Drake B, & Thompson RC (2010). Molecular characterization of Blastocystis isolates from zoo animals and their animal-keepers. Veterinary parasitology, 169 (1-2), 8-17 PMID: 20089360

Petrášová J, Uzlíková M, Kostka M, Petrželková KJ, Huffman MA, & Modrý D (2011). Diversity and host specificity of Blastocystis in syntopic primates on Rubondo Island, Tanzania. International journal for parasitology, 41 (11), 1113-20 PMID: 21854778
 
Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of blastocystis. Protist, 157 (1), 77-85 PMID: 16431158