A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)

Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)

Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!