"Show me your gut bacteria and I'll tell you if you're infected with Entamoeba"
One of my 'partners in crime', science reporter Jop de Vrieze, made me aware of a study just published now by Elise R Morton and colleagues. The study appeared in bioRxiv—The Preprint Server for Biology, operated by Cold Spring Harbor Laboratory. The study is totally in line with one of the research foci in our lab.
The paper is called 'Variation in rural African gut microbiomes is strongly shaped by parasitism and diet', and can be downloaded here. The backbone in this type of research is the recognition that studies revealing a large contrast between the microbiomes of populations in developing countries and those of populations in urban industrialised areas have shown that geography is an important factor associated with the gut microbiome, but that such studies yet have to disentangle the effects of factors such as climate, diet, host genetics, hygiene and parasitism.
It's very refreshing that for once, 'parasitism' is included in such considerations. As mentioned in one or more of my previous blog posts, we have metagenomics data stongly indicating that Blastocystis colonisation is associated with certain microbial communities. As of yet, we have no idea about cause and effet, but the idea alone is immensely intriguing.
A large and a small cyst of Entamoeba coli. Courtesy of Dr Marianne Lebbad.
Now, Morton et al. have produced data that suggest that the presence of Entamoeba—another gut-associated eukaryotic genus comprising multiple species of varying pathogencitiy—is strongly correlated with microbial composition and diversity. They showed that an individual's liability to being infected by Entamoeba could be predicted with 79% accuracy based on gut microbiome composition.
The authors used 16S PCR and Illumina-based sequencing of 16S amplicons, and I could have wished that molecular assays, e.g., the 18S PCR that we have developed in our lab + associated software, had also been used to test the faecal samples from the 64 individuals enrolled in the study in order to obtain more precise data, not only on Entamoeba but also on other human-associated gut protists, such as Blastocystis.
While alpha (intra-host) diversity of Entamoeba-positive individuals was significantly higher than that
of Entamoeba-negative individuals, analysis of the beta (inter-host) diversity revealed
that gut communities across Entamoeba-positive individuals were more similar than across Entamoeba-negative individuals, suggesting that, as alpha diversity
increases, there are fewer potential stable states for individual gut
communities, or that infection by Entamoeba drives changes in the
microbiome that are dominant over other factors.
Right—this is Entamoeba, I know, but in principle, the type of analyses that were performed in the present study could be applicable to Blastocystis, Dientamoeba, and other gut parasites, which may help us understand their role in health and disease. Are these parasites able to influence gut microbiota? Can they be used for gut microbiota manipulation? Or do they only infect people with certain microbiota profiles? Time will show... maybe.
For those of you who would like to read more about what is shaping our microbiomes and how the gut microbiota may impact on our gastrointestinal health, I recently did a couple of blog posts for United European Gastroenterology (UEG) Education that might be of some interest:
Morton ER, Lynch J, Froment A, Lafosse S, Heyer E, Przeworski M, Blekham R, Segurel L.
Variation in rural African gut microbiomes is strongly shaped by parasitism and diet. bioRxiv doi http://dx.doi.org/10.1101/016949 - accessible here.
I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.
And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.
First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.
The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:
Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.
Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis: >Saccharomyces_cerevisiae_(J01353) TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC
What you'll see is this:
As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis! This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.
If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.
This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.
What you want is sequences looking like this:
For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).
When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98%
identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here
- however, it requires access to the journal (and then look up
'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.
Other useful free online software:
For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.
And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.
Useful papers:
Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158
Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257
Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574
Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438
Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980
Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084
Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846
Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816
Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.
This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.
We are bringing a poster displaying some of our work related to our GUT18S project: A Novel Approach For Eukaryotic Phylogenetic Interrogation Of Clinical Samples Using Next Generation Sequencing Of SSU rRNA Genes; a pdf version of the poster can be downloaded here.
We were lucky enough to have a paper accepted for publication in the ISME Journal (Nature Publishing Group) in which we call for data on the "human intestinal eukaryotome".
In the paper, we start out:
"Recent developments in Next Generation Sequencing (NGS) technologies have allowed culture-independent and deep molecular analysis of the microbial diversity in faecal samples, and have provided new insights into the bacterial composition of the distal gut microbiota. Studies of the microbiome in different patient groups using metagenomics or 16S rRNA gene sequencing are increasing our knowledge of how the microbiota influences health and disease. The majority of recent advances in our understanding of human microbiota structure and dynamic changes in disease were made through phylogenetic interrogation of small subunit (SSU) rRNA (Paliy and Agans 2012). However, until recently such studies have generally failed to include data on common eukaryotic, endobiotic organisms such as single-celled parasites and yeasts ('micro-eukaryotes'). This deficiency may strongly bias the interpretation of results and ignoring an entire kingdom of organisms is a major limitation of human microbiome studies."
