Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.

The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC

What you'll see is this:

As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:

For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).

Using STADEN for Sequence Assembly by RuneStensvold

When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

This Month In Blastocystis Research (MAR 2014)

If there's one paper that really made my eye balls pop over the past 30 days, it's the paper appearing a couple of days ago in BMC Infectious Diseases by Safadi et al. on Blastocystis in a cohort of Senegalese children. The paper is open access and can be downloaded here. But I'll be jumping right at it:

A 100% prevalence of Blastocystis in a cohort of 93 Senegalese children! 

The children represented a mixed group of children with and without symptoms. And yes, they were all colonised!

Are Senegalese children obligate carriers of Blastocystis? Image courtesy of whl.travel.

I will not at all try and discuss the potential clinical implications of this. I don't think we currently have the appropriate tools to ascertain to which extent a 100% Blastocystis prevalence is a public health problem. 

However, technically and scientifically, I'm extremely pleased to see a study like this one. My group and some of my colleagues have somewhat similar data in the pipeline, and it's great to see this next generation of survey data emerging from different regions of the world, based on the use of highly sensitive molecular tools to screen for Blastocystis. I cannot emphasise the importance of this too much.

The authors hoovered faecal samples from the children for Blastocystis-specific DNA using both PCR + sequencing (barcode region) and real-time PCR. Importantly, quite a few samples negative by barcoding were positive by real-time PCR, and so if the authors had included only PCR + sequencing, the prevalence would have been only 75% or so. It may be not very surprising that barcoding PCR did not pick up all cases of Blastocystis, but then again, it has always been known that the barcoding PCR is not diagnostic - one of the primers, RD5, is a general eukaryotic primer, while the other one, BhRDr is Blastocystis-specific. Also, the PCR product is about 600 bp; diagnostic PCRs should preferably be designed to produced much smaller amplicons (100 bp or so) for a variety of reasons.

The research team subtyped all samples, and found ST3 to be the most prevalent subtype - colonising about 50% of the children. ST1 and ST2 were also common, while ST4 was found in only 2 children and only in mixed infections. Mixed subtype infections was seen in 8 cases. Note the small fraction of ST4. This subtype is very common in Europe but seems to be rare in most other regions.

There is no doubt that we with molecular tools are now starting to obtain data that represent a more precise snapshot of reality than before when tools of low sensitivity and unable to give strain information were used. And while qPCR can take us a long way in terms of precisely distinguishing positive from negative samples, we still have an amplification step that may interfere with the DNA information that we obtain. The French group involved in this study has over multiple studies done  an admirable job in terms of pursuing the extent of mixed subtype infections. Whether the data are based on sequencing of PCR products amplified by genus-specific primers, or whether real-time PCR  using genus-specific primers is used, it can still be argued that these methods have limitations due to application of genus-specific primers in both cases. It is going to be interesting to compare the evidence that we have collected from subtyping over the past few years with analysis of metagenomics data, which are independent of PCR amplification, and thus not subject to potential bias. 

A 100% prevalence means that transmission pressure is massive. Three subtypes are common. Still, mixed infections are present in less than 10%. If this is indeed a realistic picture, this may imply that once established, a Blastocystis strain is capable of keeping other strains at bay? In keeping with waht I said above, it is also possible that the extent of mixed infections is higher, and that the PCR methods only detect the more predominant strain, making the prevalence of mixed ST infection seem low.

It's tempting to believe that such a high prevalence of Blastocystis compared to Europe is due to exposure to contaminated water, but how does this explain a whopping 30% Blastocystis prevalence in the background population in Denmark, a country characterised by supreme hygienic standards and 'perfect plumbing' with all potable water being pumped up from the ground (ie. hardly no surface water)? Have all individuals positive for Blastocystis in Denmark been out traveling to more exotic countries with less well controlled water infrastructures? Or is Blastocystis just highly transmissible through e.g. direct contact? And will all who are exposed develop colonisation? What are the determinants? It's probably not fair to dismiss the idea of Blastocystis being waterborne (as one of the modes of transmission) due to the fact that Blastocystis has not been cause of waterborne outbreaks. If Blastocystis is non-pathogenic, it can easily be transmitted by water. In fact, if Blastocystis is waterborne and never gives rise to outbreaks, what does this tell us about it's pathogenic potential? Well, acute disease such as that seen for some bacteria, viruses, and Cryptosporidium, Giardia and microsporidia is probably not something that is associated with the organism.

I could have wished for allele analysis of the subtypes detected. It should be possible in all cases where barcode sequences were available, - simply and easy using this online tool. But the data is available in GenBank so everyone interested can have a look. 

There is plenty of interesting things to address, but for now I'll leave it here, and on behalf of all of us interested in Blastocystis research just thank the people behind the paper for publishing this important study!

And nope, this is no April Fool!

Literature:

El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, & Viscogliosi E (2014). Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infectious Diseases, 14 (1) PMID: 24666632

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438