All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.
ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.
Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.
So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.
Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.
Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.
So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.
Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT CTTATCGATA
Exactly! Subtype 1, allele 4!
No comments:
Post a Comment