This Month in Blastocystis Research (MAY 2014)

To me, this month was mostly about Blastocystis finding its way to the ASM 2014 general meeting. It was a huge honour for me to be one of the speakers in the Parasitology session 'Passion for Parasites', thanks to an invitation from Dr Lynne Garcia and ASM.

ASM2014 took place in Boston Convention and Exhibition Center.

It's pleasing that the Blastocystis research community is continuously expanding. I currently have contact to several research groups who are venturing into Blastocystis research, including epidemiology, genome sequence analysis, and Blastocystis (and other intestinal microbial eukaryotes (IMEs)) as part of the human intestinal microbiome. At the ICOPA2014 conference in Mexico in August, there will be a full session on Blastocystis from an IBS perspective with talks by Dr Pablo Maravilla, Kenneth Boorom, Dr Pauline D Scanlan and myself. There will also be a pre-congress workshop on molecular parasitology which will include Blastocystis subtyping arranged by Dr Juan David Ramirez Gonzalez and myself.

This month we also launched the website for the 1st International Blastocystis Symposium, which can be accessed at www.blastomeeting.com  - we hope that the meeting will receive great interest and contribute to promoting research on Blastocystis and other IMEs. Please go to the site to sign up for updates.

Moving on to 'paper of the month', I would just briefly highlight a study by Wu, Mirza and Tan, who used Caco-2 human colonic cells and different strains of Blastocystis sp. ST4 and ST7 to compare and demonstrate the strains' relative ability to adhere to enterocytes and to disturb cell barrier function. The paper is very interesting for a variety of reasons. For instance it appears that metronidazole resistance may be linked to a fitness cost as indicated by reduced adhesion ability.

But it would be nice to know how the results reflect the in vivo situation: What actually happens in the colon? It may be so that Blastocystis can adhere to enterocytes and even inflict damage as indicated in the paper, but what if Blastocystis is not able to make it anywhere near the enterocytes?

Now, some parasites are intracellular - e.g. Cryptosporidium and microsporidia -, Giardia has a ventral disc by which it can latch on to the intestinal lining; Entamoebas are motile, etc. Blastocystis is neither intracellular, nor is it motile, but can it attach to enterocytes or is it simply being 'kneeded' and passed along with the remaining luminal content by peristalsis? Or is it lodged in the mucus layer perhaps - trapped by chance, or actively making its way to/through it?

In the colon, two mucus layers exist; an inner layer void of bacteria, and an outer layer that serves as a home for some bacteria but that also prevents these bacteria from reaching the inner layer. Hence, the colon inner mucus layer separates the intestinal lining from the trillions of bacteria inhabiting our large intestine and as such has a tremendously important role in limiting bacterial contact with the epithelium and moving bacteria distally. Mucus is produced by our goblet cells and is made up by mucins, highly glycosylated proteins that we cannot degrade. Moreover, these mucins serve as food for commensal bacteria and are highly resistant to protease activity unless destabilised. The mucus layer traps antimicrobial peptides and other immune effectors and hence creates an effective barrier between the mucosal lining and the microbiota.

Some pathogenic bacteria, and also Giardia for instance, have flagella that allow them to move against the flow caused by secreted mucins, towards the intestinal epithelium, - one way of getting past the iron doors of the mucus layer.

Entamoeba histolytica possesses a lectin-like adhesin that enables it to anchor to the inner mucus layer. After actively destabilising the mucus layer, E. histolytica can disrupt the mucus layer by cysteine protease activity and get into contact with enterocytes. By enzyme activity the parasite can cleave MUC2, the major intestinal mucin, and this may be an initial step in a series of events resulting in invasive disease; however, in many cases enzymatic cleavage of MUC2 may be blocked by glycosylation of the cleavage site; this may be one of the explanations why E. histolytica infection may only sometimes proceed to invasive disease.

Recently, Fayer and colleagues observed that in histology sections Blastocystis was seen to adhere to the intestinal epithelium. However, since about 98% of the mucus is water, the mucus layer may vanish completely during histological procedures with important consequences for the interpretation of observations.

I believe that the use of the mucosal simulator of the human intestinal microbial ecosystem (M-SHIME) would be nearly ideal for studying Blastocystis. M-SHIME is an in vitro dynamic gut model that takes advantage of five double-jacketed vessels, respectively simulating the stomach, small intestine and the three colon regions. The model is supplemented with human gut microbiota and mucin-covered microcosms. My colleagues and I have applied for funding in order to use this model to study Blastocystis ecology, but so far, we have not had any luck with the funding agencies.

Genome and transcriptome studies of Blastocystis should also enable us to identify whether this organism has and expresses proteins that facilitate invasion of the mucus layer and adherence to enterocytes and in which way these potential mechanisms may be influenced.



Note to iOS users: You have the option of making a 'Blastocystis Parasite Blog' app! When you're browsing the site on your iPad for instance, simply add the site to your home screen (use the arrow/box icon in the top of the browser), and there you go - you've created an app icon on your desktop!

Literature: 

Hansson GC (2012). Role of mucus layers in gut infection and inflammation. Current Opinion in Microbiology, 15 (1), 57-62 PMID: 22177113

Fayer R, Elsasser T, Gould R, Solano G, Urban J Jr, & Santin M (2014). Blastocystis tropism in the pig intestine. Parasitology Research, 113 (4), 1465-72 PMID: 24535732 

Johansson ME, Sjövall H, & Hansson GC (2013). The gastrointestinal mucus system in health and disease. Nature Reviews  Gastroenterology & Hepatology, 10 (6), 352-61 PMID: 23478383 

Van den Abbeele, P., Roos, S., Eeckhaut, V., MacKenzie, D., Derde, M., Verstraete, W., Marzorati, M., Possemiers, S., Vanhoecke, B., Van Immerseel, F., & Van de Wiele, T. (2012). Incorporating a mucosal environment in a dynamic gut model results in a more representative colonization by lactobacilli Microbial Biotechnology, 5 (1), 106-115 DOI: 10.1111/j.1751-7915.2011.00308.x

Wu Z, Mirza H, & Tan KS (2014). Intra-subtype variation in enteroadhesion accounts for differences in epithelial barrier disruption and is associated with metronidazole resistance in Blastocystis subtype-7. PLoS Neglected Tropical Diseases, 8 (5) PMID: 24851944

Happy World Digestive Health Day!

Today is World Digestive Health Day!

The theme is 'Gut Microbes -  Importance in Health and Disease'.

United European Gastroenterology (UEG), a professional non-profit organisation combining all the leading European societies concerned with digestive diseases, has launched a short video to raise awareness of such diseases:

In 2000, 600 million patients suffered from a gastrointestinal disease. By 2025, this is predicted to double to 1.2 billion (source).

For those interested (and with access!), there is a special issue on 'The Gut Microbiome in Health and Disease' in the journal Gastroenterology, one of the most renown and established journals in the field.

I would also like to bring your attention to the 5th ASM Conference on Beneficial Microbes, September 27-30 in Washington DC. Deadline for submission of abstracts is July 14.

Wishing everyone a nice World Digestive Health Day!

Blastocystis Conference Website Launched!

I have the pleasure of introducing the official website for the 1st International Blastocystis Symposium scheduled for the 28-29 May, 2015, in Ankara, Turkey.

Please go to www.blastomeeting.com to visit and bookmark the page and to subscribe to updates via email or rss.

We'll be back shortly on the site with updates on the scientific committee, the venue, and how to submit abstracts (including deadline).

Please share. Thanks.

Planet Blastocystis

Well, no, this is not the Sun or Jupiter or any other gaseous galactic giant, nor is it Olympus Mons at half past nine, - but it's something quite as fascinating: Blastocystis. Even Blastocystis seen in a beautiful trichrome-stained fixed faecal smear viewed through a light microscope.

The image was sent to me by Dr Funda Dogruman-Al, Gazi University of Ankara. Colours and image quality have been manipulated a bit, - but especially the background colour may in fact vary substantially in trichrome stained preparations. I can point out at least five Blastocystis... even six, I think, like islands in an archipelago of microbes and debris, - reminiscent of volcanic craters with molten lava scarring the surface of a planet...

... which reminds me of an article from the magazine 'Microbe' (which I'm so fortunate to get in hard copy every month - sent to my office - what an immense luxury) by Arturo Casadevall and Ferric C Fang on the advantages and drawbacks on specialized science (April 2014 issue). In the article they cite a passage attributed to Konrad Lorenz:

Every man gets a narrower and narrower field of knowledge in which he must be an expert in order to compete with other people. The specialist knows more and more about less and less and finally knows everything about nothing.

After ten years of Blastocystis studies, it's not strange that you begin to feel the gravitational pull of Planet Blastocystis - orbiting in a remote corner of the Microbiology Galaxy, however rewarding life there may be... I therefore second the strategies brought forward in the article 'Specialized Science' to mitigate the drawbacks of specialisation, and from personal experience I believe that it is extremely important to throw yourself into a different scientific field - at least for a short while. I also think that if we keep asking ourselves why we are doing what we're doing, this will to some degree prevent us from ending up too high in our ivory towers... or spending too much time on Blastocystis - or on any other planet.

While you're here: Why not take a sneak peek at www.blastomeeting.com ?

Parasite-Microbiota-Host Interactions

One of the current mantras in microbiology is that 'bacterial cells in the human body outnumber human cells 10 to one'. This has been known for a long time, but I guess that the main reason why this is being hyped nowadays is due to the fact that current technologies now enable us to look at entire microbial communities in a given ecological niche at any time point and how for instance they relate to health and disease.

Casadevall and Pirofski already made this point clear back in 2000 in their great minireview in the journal Infection and Immunity on 'Host-Pathogen Interactions: Basic Concepts of Microbial Commensalism, Colonization, Infection, and Disease'. This is a great paper that helps us understand and distinguish between the many ways microbes impact on our body. First and foremost, it allows us to understand that microbes can be commensals in some hosts but cause disease in other hosts, and that very few microbes are obligate pathogens.

Anatomical drawing of abdomen, ca. 1900 (Elisa Schorn). Source.

Commensalism is defined by these authors as 'a state of infection that results in either no damage or clinically inapparent damage to the host, though it can elicit an immune response'. And a commensal is a 'microbe that induces either no damage or clinically inapparent damage after primary infection; a state that is thought to be established early in life'. In terms of the antibody response, 'it is not known whether these immune responses reflect the occurrence of an unidentified form of damage to the host'. Importantly, 'commensals also synthesise metabolites that are essential nutrients for the host'.

According to Casadevall and Pirofski, colonisation is 'a state of infection that results in a continuum of damage from none to great, with the latter leading to the induction of host responses that could eliminate or retain the microbe, or progress to chronicity or disease; for organisms that induce no damage during infection this state is indistinguishable from commensalism'.

I guess that to this end comes the concept of tolerance...Some single-celled parasites are common in young mammals such as calves and lambs (for instance Cryptosporidium and - it appears - microsporidia (unpublished data)), but appear to be cleared by host immune response mechanisms, while other parasites are establishing chronic colonisation, - parasites such as Entamoeba and Blastocystis. The latter parasites may also colonise humans for years on end... So why do we not eliminate these parasites? Blaser writes back in 1997: 'Failure to eliminate the parasite implies that the cost to the host is greater than the benefit. This may be due to high costs (e.g., loss of vital (...) functions), or significant benefits (e.g., protection against lethal diseases), or that both cost and benefit are relatively low'.

In Blastocystis research most scientists appear to be preoccupied by identifying a role for Blastocystis in disease, driven by the black and white concept that either it's pathogenic or not... or at least that if it can cause disease, it's by definition a pathogen! I think the paper by Casadevall and Pirofski shows with great clarity why we should try and take a much more differentiated view on Blastocystis and it's role in health and disease.

As mentioned in a previous blog post, Blastocystis is practically an obligate finding in some societies, while more rare in others. In some communities it may be common to contract it in very early childhood (infants/toddlers), while in other communities you may not be infected or infected only in adulthood. In Denmark, the prevalence in the healthy adult population is about 30%, and there may be countries where the prevalence is even lower - typically in regions, where the general population has been 'intestinally defaunated' (presumably due to excessive hygiene combined with a Westernised diet). And so, in some places this parasite is getting so uncommon that it may at some point become a cause of disease, a so-called 'emerging pathogen'... Conjectural maybe, but still not far fetched.

Simultaneously, evidence is emerging that intestinal microbial eukaryotes (Blastocystis and Dientamoeba fragilis) are significantly more common in healthy individuals than in patients with gastrointestinal disease such as IBS and - especially - IBD, suggesting that these parasites are protective of functional and organic bowel disease. Do they prime our immune system in a beneficial way? Do they select for beneficial bacteria? Do they keep potential harmful microbial intruders at bay? Could they be synthesising metabolites beneficial to the host just like ciliates involved in fermentation processes in the large intestine of various herbivorous mammals?

This is why the exploration of the structure and function of intestinal pro- and eukaryotic communities is so important. For instance, can we link Blastocystis to any intestinal microbial patterns? At our lab, we think we can, and it's something that we will try and explore further (if funding can be obtained). Our null hypotheses include the following:

1) The distribution of pro- and eukaryotes is random (for instance: Blastocystis is not statistically associated with the presence of particular bacteria or other eukaryotes (fungi, parasites)).

2) The introduction of a Blastocystis strain into an intestinal microbial niche does not cause alteration of the composition of the pro- and eukaryotic flora. This can be studied using an animal model, and it is tempting to try and study host immunological parameters during and after challenge with Blastocystis. Also gene expression in both host and microbial communities could be studied.

Take home message is that we should be cautious with regard to deeming a parasite as being either 'pathogenic' or 'non-pathogenic'... parasites may have a multitude of functions and may impact their hosts in a variety of ways that together with all other types of impact from and interactions with other microorganisms (microbiota) results in a health/disease matrix in every single individual.

Finally: Here's to pageview # 200,000! See you in Boston on Sunday morning at the #ASM2014 conference: Passion for Parasites !

Literature:

Blaser, M. (1997). Ecology of Helicobacter pylori in the human stomach. Journal of Clinical Investigation, 100 (4), 759-762 DOI: 10.1172/JCI119588  

Casadevall, A., & Pirofski, L. (2000). Host-Pathogen Interactions: Basic Concepts of Microbial Commensalism, Colonization, Infection, and Disease. Infection and Immunity, 68 (12), 6511-6518 DOI: 10.1128/IAI.68.12.6511-6518.2000

This Month In Blastocystis Research (APR 2014)

Due to all sorts of activities I have not been able to update myself with 'novelties' in the scientific Blastocystis literature lately.

Instead, I would like to highlight two review/opinion papers on the use of PCR-based methods for diagnosis of intestinal parasitic infections in the clinical microbiology laboratory.

Both papers have been published very recently (actually one is still 'in press'). The first is co-authored by Jaco J Verweij and myself, and appears in the April issue of 'Clinical Microbiology Reviews'. This paper aims to provide a relatively systematic review of the extent and relevance of PCR- and sequencing-based methods for diagnosis and epidemiology studies of intestinal parasites, and is as such an inventory of all sorts of DNA-based diagnostic and typing modalities for individual protists and helminths.

The second one is authored solely by Jaco J Verweij and is currently in the 'first online' section in the journal 'Parasitology'. This paper offers a discussion of the application of PCR-based method as a supplementary tool or a substitute for conventional methods (microscopy, antigen detection, etc.). Dr Verweij deals with central questions such as 'Is Molecular Detection Good Enough?' and 'Is Molecular Detection Too Good To Be True?'.

And so these two papers complement each other quite well. For those interested in the very low prevalence of intestinal helminth infections in the Western world, the latter paper has a table which summarizes some quite stunning data.

Although DNA-based methods currently in use do have quite a few limitations, I do believe that for a long while the application of species- and genus-specific PCR methods (real-time PCR, conventional PCR + sequencing, etc.) will appear relevant and state-of-the-art. Dr Verweij, I and a few of our colleagues around the world are currently discussing to which extent next generation sequencing methods can be used to

• generate data that can assist us in identifying the role of pro- and eukaryote microbial communities in health and disease
• serve as a tool to generate sequences that can be processed by designated software and thereby identify patterns of microbial communities associated with various disease and health conditions

To this end, at the Laboratory of Parasitology, Statens Serum Institut, we are currently assisting in the development of a software called BIONmeta. BION meta is an open-source package for rRNA based pro- and eukaryote community analysis. Like Qiime and Mothur it is open source but with a growing number of advantages. The package has so far been developed mostly by Niels Larsen (DK), one of the original Ribosomal Database Project authors. It is as yet unpublished, but has been selected for in-house trial-use by companies and institutions that also partly sponsor its development.When relevant, I'll post more information on this software.

References:

Verweij JJ, & Stensvold CR (2014). Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clinical Microbiology Reviews, 27 (2), 371-418 PMID: 24696439

Verweij, JJ. (2014). Application of PCR-based methods for diagnosis of intestinal parasitic infections in the clinical laboratory Parasitology, 1-10 DOI: 10.1017/S0031182014000419

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.

The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC

What you'll see is this:

As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:

For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).

Using STADEN for Sequence Assembly by RuneStensvold

When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

This Month In Blastocystis Research (MAR 2014)

If there's one paper that really made my eye balls pop over the past 30 days, it's the paper appearing a couple of days ago in BMC Infectious Diseases by Safadi et al. on Blastocystis in a cohort of Senegalese children. The paper is open access and can be downloaded here. But I'll be jumping right at it:

A 100% prevalence of Blastocystis in a cohort of 93 Senegalese children! 

The children represented a mixed group of children with and without symptoms. And yes, they were all colonised!

Are Senegalese children obligate carriers of Blastocystis? Image courtesy of whl.travel.

I will not at all try and discuss the potential clinical implications of this. I don't think we currently have the appropriate tools to ascertain to which extent a 100% Blastocystis prevalence is a public health problem. 

However, technically and scientifically, I'm extremely pleased to see a study like this one. My group and some of my colleagues have somewhat similar data in the pipeline, and it's great to see this next generation of survey data emerging from different regions of the world, based on the use of highly sensitive molecular tools to screen for Blastocystis. I cannot emphasise the importance of this too much.

The authors hoovered faecal samples from the children for Blastocystis-specific DNA using both PCR + sequencing (barcode region) and real-time PCR. Importantly, quite a few samples negative by barcoding were positive by real-time PCR, and so if the authors had included only PCR + sequencing, the prevalence would have been only 75% or so. It may be not very surprising that barcoding PCR did not pick up all cases of Blastocystis, but then again, it has always been known that the barcoding PCR is not diagnostic - one of the primers, RD5, is a general eukaryotic primer, while the other one, BhRDr is Blastocystis-specific. Also, the PCR product is about 600 bp; diagnostic PCRs should preferably be designed to produced much smaller amplicons (100 bp or so) for a variety of reasons.

The research team subtyped all samples, and found ST3 to be the most prevalent subtype - colonising about 50% of the children. ST1 and ST2 were also common, while ST4 was found in only 2 children and only in mixed infections. Mixed subtype infections was seen in 8 cases. Note the small fraction of ST4. This subtype is very common in Europe but seems to be rare in most other regions.

There is no doubt that we with molecular tools are now starting to obtain data that represent a more precise snapshot of reality than before when tools of low sensitivity and unable to give strain information were used. And while qPCR can take us a long way in terms of precisely distinguishing positive from negative samples, we still have an amplification step that may interfere with the DNA information that we obtain. The French group involved in this study has over multiple studies done  an admirable job in terms of pursuing the extent of mixed subtype infections. Whether the data are based on sequencing of PCR products amplified by genus-specific primers, or whether real-time PCR  using genus-specific primers is used, it can still be argued that these methods have limitations due to application of genus-specific primers in both cases. It is going to be interesting to compare the evidence that we have collected from subtyping over the past few years with analysis of metagenomics data, which are independent of PCR amplification, and thus not subject to potential bias. 

A 100% prevalence means that transmission pressure is massive. Three subtypes are common. Still, mixed infections are present in less than 10%. If this is indeed a realistic picture, this may imply that once established, a Blastocystis strain is capable of keeping other strains at bay? In keeping with waht I said above, it is also possible that the extent of mixed infections is higher, and that the PCR methods only detect the more predominant strain, making the prevalence of mixed ST infection seem low.

It's tempting to believe that such a high prevalence of Blastocystis compared to Europe is due to exposure to contaminated water, but how does this explain a whopping 30% Blastocystis prevalence in the background population in Denmark, a country characterised by supreme hygienic standards and 'perfect plumbing' with all potable water being pumped up from the ground (ie. hardly no surface water)? Have all individuals positive for Blastocystis in Denmark been out traveling to more exotic countries with less well controlled water infrastructures? Or is Blastocystis just highly transmissible through e.g. direct contact? And will all who are exposed develop colonisation? What are the determinants? It's probably not fair to dismiss the idea of Blastocystis being waterborne (as one of the modes of transmission) due to the fact that Blastocystis has not been cause of waterborne outbreaks. If Blastocystis is non-pathogenic, it can easily be transmitted by water. In fact, if Blastocystis is waterborne and never gives rise to outbreaks, what does this tell us about it's pathogenic potential? Well, acute disease such as that seen for some bacteria, viruses, and Cryptosporidium, Giardia and microsporidia is probably not something that is associated with the organism.

I could have wished for allele analysis of the subtypes detected. It should be possible in all cases where barcode sequences were available, - simply and easy using this online tool. But the data is available in GenBank so everyone interested can have a look. 

There is plenty of interesting things to address, but for now I'll leave it here, and on behalf of all of us interested in Blastocystis research just thank the people behind the paper for publishing this important study!

And nope, this is no April Fool!

Literature:

El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, & Viscogliosi E (2014). Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infectious Diseases, 14 (1) PMID: 24666632

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438

Blastocystis Parasite Blog - 2 Years Anniversary!

Today marks the 2 Years Anniversary of the Blastocytis Parasite Blog! And tomorrow my daughter will be turning three, so there is plenty of reason to celebrate!

My 'Birthday Special' is a collection of links to blog posts that are among the most popular or most unusual ones; a couple of them have been slightly edited (typos and updates).

But before that just a couple of announcements:
A colleague of mine will be at the Digestive Diasese Week in Chicago from 3-6 May 2014 presenting an abstract with the title: 'Dientamoeba fragilis and Blastocytis - two parasites associated with gastrointestinal health'. The title may have a harsh connotation to some, but soon I will be posting the abstract here on the blog, and you will understand why we chose this title.

Next, I'd like to encourage colleagues to come up with suggestions for topics and guest bloggers.

Soon, I'll be doing a separate post on tools available for students/researchers to detect and characterise Blastocystis in samples from humans and animals.

That's it for now; here are the links!

1. The Circular Problem of Blastocystis
2. Amelioration of Colitis by Parasites - or "An Elliot & Weinstock Special"
3. Do IBS Patients Lack Blastocystis and Dientamoeba??
4. Micro-Eukaryotic Diversity in The Human Instestine
5. Blastocystis aux Enfers

What's In A Name?

When people have had their stools examined and are told that they have Blastocystis, most of them will not have a clue about what that is. And eventually they'll be told that it's a parasite. A parasite? As in tapeworm? Ok it's not. But then what? As in malaria? Oh... ok, I see... So it's....? Huh? As in ... what???

Now, which are those parasites in and on your body, and what in fact makes a parasite? Depends on who you ask. For parasitologists and public health/clinical microbiologists, a parasite means something along the lines of a eukaryotic organism (i.e. not a bacterium and not a virus) that is not a fungus and that is capable of living and maybe even multiplying on or inside another organism. Some organisms are considered somewhere in between parasites and fungi, such as microsporidia and Pneumocystis. But whether an organism is a fungus or a parasite is not important in most cases. You will also sometimes see that 'parasite' is used as a term meant to cover living organisms causing disease, and in this sense the term may include for instance bacteria and viruses; for instance. A lot of research deals with 'host-parasite' relationships, evolution of virulence and tolerance in parasites and hosts, respectively; also here, bacteria may be referred to as parasites.

 Mosquitos are practically parasites that may transmit other parasites. Source (eyeweed on Flickr).

The word 'parasite' stems from Greek, and means something like 'eating beside' or 'eating at someone else's table'. Parasitism is a non-mutual symbiotic relationship where one organism (the parasite) benefits at the expense of another (the host).

People like me usually divide parasites (sensu stricto) into protozoa (single-celled) and helminths (multi-cellular; worms). Effectively, this should be protists and helminths, since not all single-celled parasitic eukaryotes are protozoa. Please note that most protists and helminths (the nematode fraction) are free-living, - but some have adapted a parasitic life style and very effectively so.

So, when we're told by doctors that we are in fact hosting parasites, - how do we react? I guess  some of us will be quite alarmed: Creatures eating defenseless hosts from within, castrating them and turning them into zombies come to our minds, for instance Sacculina, Dicrocoelium, and Leucochloridium, just to mention a few ones (if you're not familiar with these ones, I suggest you look them up - you will hardly believe what they are capable of doing, and despite the horrifying subtlety and cold-bloodedness with which these creatures operate, one can hardly help marveling on how cunningly evolution makes way for some organisms' ability to exploit others). Other parasites are known to cause less spectacular phenotypic changes while having huge consequences for human health and disease: Malaria continues to be a significant cause of morbidity and mortality in many larger regions, and recently, diarrhoea caused by species of Cryptospordium was recognised as one of the most significant health issues in infants and toddlers in select sentinel areas sub-Saharan Africa and South Asia.

Some parasites, however, are commensals (ie. they just sit there with a more or less neutral outcome) or even beneficial to the host; for instance, there's evidence of ciliates assisting herbivores in metabolising cellulose. So while, these organisms from one point of view are parasites, the hole symbiotic relationship between these protozoa and herbivores may be seen as mutualistic. Maybe this particular relationship started out as 'parasitsm' but developed into 'mutualism'? There may be a lot more examples of this. Animals usually host various types of parasites, and humans probably used to host a much larger zoo of parasites than many of us do today; what is the public health significance of the recent and rapid 'defaunation' of humans in certain parts of the world?

At least technically, Blastocystis is also a parasite: Sitting in the colon, it lives on food delivered by its host, and thereby it certainly eats at someone else's table. Moreover, the parasite is probably not capable of completing its life cycle without a host. But what does it do apart from eating? Does it do us any good just like the ciliates in the herbivores? Blastocystis has co-evolved with humans (and other host species) and maybe humans have learned to exploit Blastocystis so that it's not only Blastocystis exploiting us? Does Blastocystis compete with other organisms in the gut? Does it secrete substances that impact other organisms including the host, and if so, in what way? What's its impact on the immune system? Etc.

I guess the take-home message here is that 'parasite' is just a word, - a name for something, and there are examples of parasitism turning into mutualism. Not all parasites induce disease, and parasites are not always organisms that should be sought eradicated.

Literature:

Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow SO, Sur D, Breiman RF, Faruque AS, Zaidi AK, Saha D, Alonso PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T, Kanungo S, Ochieng JB, Omore R, Oundo JO, Hossain A, Das SK, Ahmed S, Qureshi S, Quadri F, Adegbola RA, Antonio M, Hossain MJ, Akinsola A, Mandomando I, Nhampossa T, Acácio S, Biswas K, O'Reilly CE, Mintz ED, Berkeley LY, Muhsen K, Sommerfelt H, Robins-Browne RM, & Levine MM (2013). Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet, 382 (9888), 209-22 PMID: 23680352

Veira DM (1986). The role of ciliate protozoa in nutrition of the ruminant. Journal of Animal Science, 63 (5), 1547-60 PMID: 3098727